Stem-loop sequence hsa-mir-133a-2

AccessionMI0000451 (change log)
Symbol HGNC:MIR133A2
DescriptionHomo sapiens miR-133a-2 stem-loop
Gene family MIPF0000029; mir-133
Literature search

381 open access papers mention hsa-mir-133a-2
(1750 sentences)

Stem-loop
   g  a    --     uuu    g       aa  u  a        g cug 
5'  gg gcca  aaugc   gcua agcuggu  aa gg accaaauc a   u
    || ||||  |||||   |||| |||||||  || || |||||||| |    
3'  cc cggu  uuacg   cgau ucgacca  uu cc ugguuuag u   c
   g  g    ag     ugu    g       ac  c  c        g aac 
Get sequence
Deep sequencing
295985 reads, 543 reads per million, 143 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1] later verified in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 62564912-62565013 [+]
sense
OTTHUMT00000080244 ; DNAJC5-001; exon 5
OTTHUMT00000080245 ; DNAJC5-002; exon 6
ENST00000360864 ; DNAJC5-001; exon 5
ENST00000470551 ; DNAJC5-002; exon 6
Database links

Mature sequence hsa-miR-133a-5p

Accession MIMAT0026478
Sequence

22 - 

agcugguaaaauggaaccaaau

 - 43

Get sequence
Deep sequencing17566 reads, 117 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

Mature sequence hsa-miR-133a-3p

Accession MIMAT0000427
Sequence

59 - 

uuugguccccuucaaccagcug

 - 80

Get sequence
Deep sequencing574422 reads, 143 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).