Stem-loop sequence hsa-mir-133a-2

Accession MI0000451
Symbol HGNC:MIR133A2
Description Homo sapiens miR-133a-2 stem-loop
Gene family MIPF0000029; mir-133
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-133_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice. Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
g  a    --     uuu    g       aa  u  a        g cug 
 gg gcca  aaugc   gcua agcuggu  aa gg accaaauc a   u
 || ||||  |||||   |||| |||||||  || || |||||||| |    
 cc cggu  uuacg   cgau ucgacca  uu cc ugguuuag u   c
g  g    ag     ugu    g       ac  c  c        g aac 
Get sequence
Deep sequencing
154 reads, 22 experiments
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1] later verified in human [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr20: 61162119-61162220 [+]
sense
OTTHUMT00000109263 ; C20orf166-002; intron 1
OTTHUMT00000109263 ; C20orf166-002; intron 1
OTTHUMT00000109263 ; C20orf166-002; intron 1
OTTHUMT00000109262 ; C20orf166-001; intron 2
OTTHUMT00000109262 ; C20orf166-001; 3'UTR (exon 3)
OTTHUMT00000109262 ; C20orf166-001; 3'UTR (exon 3)
ENST00000370523 ; C20orf166-002; intron 1
ENST00000370523 ; C20orf166-002; intron 1
ENST00000370523 ; C20orf166-002; intron 1
ENST00000370527 ; C20orf166-001; intron 2
ENST00000370524 ; C20orf166-201; intron 2
ENST00000370524 ; C20orf166-201; intron 2
ENST00000370524 ; C20orf166-201; intron 2
ENST00000370527 ; C20orf166-001; 3'UTR (exon 3)
ENST00000370527 ; C20orf166-001; 3'UTR (exon 3)
Database links

Mature sequence hsa-miR-133a

Accession MIMAT0000427
Sequence

59 - 

uuugguccccuucaaccagcug

 - 80

Get sequence
Deep sequencing 249 reads, 16 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).