Stem-loop sequence hsa-mir-133a-1

Accession MI0000450
Symbol HGNC:MIR133A1
Description Homo sapiens miR-133a-1 stem-loop
Gene family MIPF0000029; mir-133
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-133_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice. Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a      uuu    g       aa  u  a        gccuc 
5'  caaugc   gcua agcuggu  aa gg accaaauc     u
    ||||||   |||| |||||||  || || ||||||||      
3'  guuacg   cgau ucgacca  uu cc ugguuuag     u
   a      uau    g       ac  c  c        guaac 
Get sequence
Deep sequencing
7111 reads, 2.05e+03 reads per million, 38 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr18: 21825698-21825785 [-]
sense
OTTHUMT00000254903 ; OSBPL1A-002; intron 1
OTTHUMT00000446405 ; OSBPL1A-015; intron 1
OTTHUMT00000446434 ; OSBPL1A-016; intron 1
OTTHUMT00000446357 ; OSBPL1A-003; intron 3
OTTHUMT00000446406 ; OSBPL1A-014; intron 4
OTTHUMT00000254902 ; OSBPL1A-001; intron 15
ENST00000399443 ; OSBPL1A-002; intron 1
ENST00000578055 ; OSBPL1A-015; intron 1
ENST00000585247 ; OSBPL1A-016; intron 1
ENST00000357041 ; OSBPL1A-003; intron 3
ENST00000584119 ; OSBPL1A-014; intron 4
ENST00000319481 ; OSBPL1A-001; intron 15
Clustered miRNAs
< 10kb from hsa-mir-133a-1
hsa-mir-1-2 chr18: 21829004-21829088 [-]
hsa-mir-133a-1 chr18: 21825698-21825785 [-]
Database links

Mature sequence hsa-miR-133a-5p

Accession MIMAT0026478
Sequence

16 - 

agcugguaaaauggaaccaaau

 - 37

Get sequence
Deep sequencing 245 reads, 22 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence hsa-miR-133a-3p

Accession MIMAT0000427
Sequence

53 - 

uuugguccccuucaaccagcug

 - 74

Get sequence
Deep sequencing 1228 reads, 26 experiments
Evidence experimental; cloned [2], Illumina [3]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).