Stem-loop sequence hsa-mir-132

AccessionMI0000449 (change log)
Symbol HGNC:MIR132
DescriptionHomo sapiens miR-132 stem-loop
Gene family MIPF0000065; mir-132
Literature search

285 open access papers mention hsa-mir-132
(1553 sentences)

Stem-loop
   c   cccc    -  c a    a         uuc          --gu g 
5'  cgc    gcgu cu c gggc accguggcu   gauuguuacu    g g
    |||    |||| || | |||| |||||||||   ||||||||||    |  
3'  gcg    cgca ga g cccg ugguaccga   cugacaaugg    c a
   c   cacc    c  c c    c         cau          aggu a 
Get sequence
Deep sequencing
82337 reads, 752 reads per million, 157 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 2049908-2050008 [-]
sense
OTTHUMT00000438476 ; SMG6-011; intron 1
OTTHUMT00000438474 ; SMG6-010; intron 2
OTTHUMT00000438059 ; SMG6-005; intron 5
OTTHUMT00000438057 ; SMG6-002; intron 6
OTTHUMT00000437826 ; SMG6-001; intron 13
ENST00000570874 ; SMG6-011; intron 1
ENST00000575454 ; SMG6-010; intron 2
ENST00000536871 ; SMG6-005; intron 5
ENST00000354901 ; SMG6-002; intron 6
ENST00000263073 ; SMG6-001; intron 13
ENST00000544865 ; SMG6-201; intron 13
Clustered miRNAs
< 10kb from hsa-mir-132
hsa-mir-212chr17: 2050271-2050380 [-]
hsa-mir-132chr17: 2049908-2050008 [-]
Database links

Mature sequence hsa-miR-132-5p

Accession MIMAT0004594
Previous IDshsa-miR-132*
Sequence

23 - 

accguggcuuucgauuguuacu

 - 44

Get sequence
Deep sequencing9417 reads, 153 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-132-3p

Accession MIMAT0000426
Previous IDshsa-miR-132
Sequence

59 - 

uaacagucuacagccauggucg

 - 80

Get sequence
Deep sequencing72776 reads, 156 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).