Stem-loop sequence hsa-mir-132

Accession MI0000449
Symbol HGNC:MIR132
Description Homo sapiens miR-132 stem-loop
Gene family MIPF0000065; mir-132
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-132. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-132 microRNA is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms, generally reducing protein levels through the cleavage of mRNAs or the repression of their translation. Several targets for miR-132 have been described, including mediators of neurological development, synaptic transmission, inflammation and angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c   cccc    -  c a    a         uuc          --gu g 
 cgc    gcgu cu c gggc accguggcu   gauuguuacu    g g
 |||    |||| || | |||| |||||||||   ||||||||||    |  
 gcg    cgca ga g cccg ugguaccga   cugacaaugg    c a
c   cacc    c  c c    c         cau          aggu a 
Get sequence
Deep sequencing
635 reads, 40 experiments
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr17: 1953202-1953302 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-132
hsa-mir-212 chr17: 1953565-1953674 [-]
hsa-mir-132 chr17: 1953202-1953302 [-]
Database links

Mature sequence hsa-miR-132-5p

Accession MIMAT0004594
Previous IDs hsa-miR-132*
Sequence

23 - 

accguggcuuucgauuguuacu

 - 44

Get sequence
Deep sequencing 81 reads, 21 experiments
Evidence experimental; cloned [2]
Predicted targets

Mature sequence hsa-miR-132-3p

Accession MIMAT0000426
Previous IDs hsa-miR-132
Sequence

59 - 

uaacagucuacagccauggucg

 - 80

Get sequence
Deep sequencing 549 reads, 35 experiments
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).