Stem-loop sequence hsa-mir-130a

Accession

MI0000448

Symbol

HGNC:MIR130A

Description

Homo sapiens miR-130a stem-loop

Gene family

MIPF0000034; mir-130

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma.

Stem-loop

u     -       a        c      ug  a   ucu  a 
 gcugc uggccag gcucuuuu acauug  cu cug   gc c
 ||||| ||||||| |||||||| ||||||  || |||   ||  
 ugaug gccgguu cgggaaaa uguaac  ga gau   ug c
g     u       a        u      gu  c   cac  u 

Deep sequencing

15954 reads, 31 experiments

Comments

miR-130a was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2].

Genome context

• Coordinates (GRCh37.p5): chr11: 57408671-57408759 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000393362 ; AP000662.4-002; intron 1

  OTTHUMT00000393363 ; AP000662.4-001; intron 1

  OTTHUMT00000393362 ; AP000662.4-002; intron 1

  OTTHUMT00000393363 ; AP000662.4-001; intron 1

  OTTHUMT00000393362 ; AP000662.4-002; intron 1

  OTTHUMT00000393363 ; AP000662.4-001; intron 1

  ENST00000528466 ; AP000662.4-002; intron 1

  ENST00000530595 ; AP000662.4-001; intron 1

  ENST00000528466 ; AP000662.4-002; intron 1

  ENST00000530595 ; AP000662.4-001; intron 1

  ENST00000528466 ; AP000662.4-002; intron 1

  ENST00000530595 ; AP000662.4-001; intron 1

Database links

• ENTREZGENE: 406919;MIR130A
• HGNC: 31514;MIR130A

Mature sequence hsa-miR-130a-5p

• Accession: MIMAT0004593
• Previous IDs: hsa-miR-130a*
• Sequence: 21 - uucacauugugcuacugucugc - 42
• Deep sequencing: 88 reads, 19 experiments
• Evidence: experimental; cloned [3]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-130a-5p
  • MICRORNA.ORG:hsa-miR-130a-5p
  • MIRDB:hsa-miR-130a-5p
  • RNA22-HSA:hsa-miR-130a-5p
  • TARGETMINER:hsa-miR-130a-5p
  • PICTAR-VERT:hsa-miR-130a

Mature sequence hsa-miR-130a-3p

• Accession: MIMAT0000425
• Previous IDs: hsa-miR-130a
• Sequence: 55 - cagugcaauguuaaaagggcau - 76
• Deep sequencing: 15866 reads, 22 experiments
• Evidence: experimental; cloned [2-4], Northern [2]
• Validated targets:
  • TARBASE:hsa-miR-130a-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-130a-3p
  • MICRORNA.ORG:hsa-miR-130a-3p
  • MIRDB:hsa-miR-130a-3p
  • RNA22-HSA:hsa-miR-130a-3p
  • TARGETMINER:hsa-miR-130a-3p
  • TARGETSCAN-VERT:hsa-miR-130a
  • PICTAR-VERT:hsa-miR-130a

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).