Stem-loop sequence hsa-mir-130a

AccessionMI0000448 (change log)
Symbol HGNC:MIR130A
DescriptionHomo sapiens miR-130a stem-loop
Gene family MIPF0000034; mir-130
Literature search

188 open access papers mention hsa-mir-130a
(1132 sentences)

Stem-loop
   u     -       a        c      ug  a   ucu  a 
5'  gcugc uggccag gcucuuuu acauug  cu cug   gc c
    ||||| ||||||| |||||||| ||||||  || |||   ||  
3'  ugaug gccgguu cgggaaaa uguaac  ga gau   ug c
   g     u       a        u      gu  c   cac  u 
Get sequence
Deep sequencing
296303 reads, 1.81e+03 reads per million, 158 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-130a was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 57641198-57641286 [+]
intergenic
Database links

Mature sequence hsa-miR-130a-5p

Accession MIMAT0004593
Previous IDshsa-miR-130a*
Sequence

15 - 

gcucuuuucacauugugcuacu

 - 36

Get sequence
Deep sequencing1372 reads, 107 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

Mature sequence hsa-miR-130a-3p

Accession MIMAT0000425
Previous IDshsa-miR-130a
Sequence

55 - 

cagugcaauguuaaaagggcau

 - 76

Get sequence
Deep sequencing294919 reads, 158 experiments
Evidence experimental; cloned [2-4], Northern [2]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).