Stem-loop sequence hsa-mir-130a

Accession MI0000448
Symbol HGNC:MIR130A
Description Homo sapiens miR-130a stem-loop
Gene family MIPF0000034; mir-130
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u     -       a        c      ug  a   ucu  a 
 gcugc uggccag gcucuuuu acauug  cu cug   gc c
 ||||| ||||||| |||||||| ||||||  || |||   ||  
 ugaug gccgguu cgggaaaa uguaac  ga gau   ug c
g     u       a        u      gu  c   cac  u 
Get sequence
Deep sequencing
15954 reads, 31 experiments
Comments

miR-130a was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr11: 57408671-57408759 [+]
sense
OTTHUMT00000393362 ; AP000662.4-002; intron 1
OTTHUMT00000393363 ; AP000662.4-001; intron 1
OTTHUMT00000393362 ; AP000662.4-002; intron 1
OTTHUMT00000393363 ; AP000662.4-001; intron 1
OTTHUMT00000393362 ; AP000662.4-002; intron 1
OTTHUMT00000393363 ; AP000662.4-001; intron 1
ENST00000528466 ; AP000662.4-002; intron 1
ENST00000530595 ; AP000662.4-001; intron 1
ENST00000528466 ; AP000662.4-002; intron 1
ENST00000530595 ; AP000662.4-001; intron 1
ENST00000528466 ; AP000662.4-002; intron 1
ENST00000530595 ; AP000662.4-001; intron 1
Database links

Mature sequence hsa-miR-130a-5p

Accession MIMAT0004593
Previous IDs hsa-miR-130a*
Sequence

21 - 

uucacauugugcuacugucugc

 - 42

Get sequence
Deep sequencing 88 reads, 19 experiments
Evidence experimental; cloned [3]
Predicted targets

Mature sequence hsa-miR-130a-3p

Accession MIMAT0000425
Previous IDs hsa-miR-130a
Sequence

55 - 

cagugcaauguuaaaagggcau

 - 76

Get sequence
Deep sequencing 15866 reads, 22 experiments
Evidence experimental; cloned [2-4], Northern [2]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).