Stem-loop sequence hsa-mir-128-1

AccessionMI0000447 (change log)
Previous IDshsa-mir-128a
Symbol HGNC:MIR128-1
DescriptionHomo sapiens miR-128-1 stem-loop
Gene family MIPF0000048; mir-128
Literature search

174 open access papers mention hsa-mir-128-1
(979 sentences)

Stem-loop
   u    u      uuc       uag      cu       u 
5'  gagc guugga   ggggccg   cacugu  gagaggu u
    |||| ||||||   |||||||   ||||||  |||||||  
3'  uucg cgacuu   cucuggc   gugaca  cucuuua a
   c    u      uuu       caa      --       c 
Get sequence
Deep sequencing
235422 reads, 694 reads per million, 156 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical [3]. The sequences are therefore renamed mir-128-1 and mir-128-2.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 135665397-135665478 [+]
antisense
OTTHUMT00000337383 ; AC016725.4-003; intron 1
OTTHUMT00000337382 ; AC016725.4-002; intron 1
OTTHUMT00000337381 ; AC016725.4-001; intron 1
ENST00000392929 ; CCNT2-AS1-003; intron 1
ENST00000413962 ; CCNT2-AS1-002; intron 1
ENST00000428857 ; CCNT2-AS1-001; intron 1
ENST00000537615 ; CCNT2-AS1-201; intron 1
Database links

Mature sequence hsa-miR-128-1-5p

Accession MIMAT0026477
Sequence

15 - 

cggggccguagcacugucugaga

 - 37

Get sequence
Deep sequencing688 reads, 94 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

Mature sequence hsa-miR-128-3p

Accession MIMAT0000424
Previous IDshsa-miR-128a
Sequence

50 - 

ucacagugaaccggucucuuu

 - 70

Get sequence
Deep sequencing466302 reads, 157 experiments
Evidence experimental; cloned [3], Illumina [4]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).