Stem-loop sequence hsa-mir-128-1

Accession

MI0000447

Previous IDs

hsa-mir-128a

Symbol

HGNC:MIR128-1

Description

Homo sapiens miR-128-1 stem-loop

Gene family

MIPF0000048; mir-128

Stem-loop

u    u      uuc       uag      cu       u 
 gagc guugga   ggggccg   cacugu  gagaggu u
 |||| ||||||   |||||||   ||||||  |||||||  
 uucg cgacuu   cucuggc   gugaca  cucuuua a
c    u      uuu       caa      --       c 

Deep sequencing

25314 reads, 28 experiments

Comments

The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical [3]. The sequences are therefore renamed mir-128-1 and mir-128-2.

Genome context

• Coordinates (GRCh37.p5): chr2: 136422967-136423048 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000331718 ; R3HDM1-007; intron 7

  OTTHUMT00000331718 ; R3HDM1-007; intron 7

  OTTHUMT00000331718 ; R3HDM1-007; intron 7

  OTTHUMT00000331545 ; R3HDM1-004; intron 15

  OTTHUMT00000331546 ; R3HDM1-005; intron 15

  OTTHUMT00000331545 ; R3HDM1-004; intron 15

  OTTHUMT00000331546 ; R3HDM1-005; intron 15

  OTTHUMT00000331545 ; R3HDM1-004; intron 15

  OTTHUMT00000331546 ; R3HDM1-005; intron 15

  OTTHUMT00000254659 ; R3HDM1-001; intron 18

  OTTHUMT00000331717 ; R3HDM1-006; intron 18

  OTTHUMT00000254659 ; R3HDM1-001; intron 18

  OTTHUMT00000331717 ; R3HDM1-006; intron 18

  OTTHUMT00000254659 ; R3HDM1-001; intron 18

  OTTHUMT00000331717 ; R3HDM1-006; intron 18

  ENST00000429703 ; R3HDM1-007; intron 7

  ENST00000429703 ; R3HDM1-007; intron 7

  ENST00000429703 ; R3HDM1-007; intron 7

  ENST00000409478 ; R3HDM1-004; intron 15

  ENST00000410054 ; R3HDM1-005; intron 15

  ENST00000329971 ; R3HDM1-201; intron 15

  ENST00000409478 ; R3HDM1-004; intron 15

  ENST00000410054 ; R3HDM1-005; intron 15

  ENST00000329971 ; R3HDM1-201; intron 15

  ENST00000409478 ; R3HDM1-004; intron 15

  ENST00000410054 ; R3HDM1-005; intron 15

  ENST00000329971 ; R3HDM1-201; intron 15

  ENST00000264160 ; R3HDM1-001; intron 18

  ENST00000409606 ; R3HDM1-006; intron 18

  ENST00000264160 ; R3HDM1-001; intron 18

  ENST00000409606 ; R3HDM1-006; intron 18

  ENST00000264160 ; R3HDM1-001; intron 18

  ENST00000409606 ; R3HDM1-006; intron 18

Database links

• ENTREZGENE: 406915;MIR128-1
• HGNC: 31510;MIR128-1

Mature sequence hsa-miR-128

• Accession: MIMAT0000424
• Previous IDs: hsa-miR-128a
• Sequence: 50 - ucacagugaaccggucucuuu - 70
• Deep sequencing: 50409 reads, 30 experiments
• Evidence: experimental; cloned [2-3]
• Validated targets:
  • MIRECORDS:hsa-miR-128
  • MIRTARBASE:hsa-miR-128
  • TARBASE:hsa-miR-128
• Predicted targets:
  • DIANA-MICROT:hsa-miR-128
  • MICRORNA.ORG:hsa-miR-128
  • MIRDB:hsa-miR-128
  • RNA22-HSA:hsa-miR-128
  • TARGETMINER:hsa-miR-128
  • TARGETSCAN-VERT:hsa-miR-128
  • PICTAR-VERT:hsa-miR-128a

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).