Stem-loop sequence hsa-mir-125b-1

Accession

MI0000446

Symbol

HGNC:MIR125B1

Description

Homo sapiens miR-125b-1 stem-loop

Gene family

MIPF0000017; mir-125

Stem-loop

u    uc   u   uc  ug   c           au     c 
 gcgc  cuc cag  cc  aga ccuaacuugug  guuua c
 ||||  ||| |||  ||  ||| |||||||||||  ||||| g
 cgug  gag guc  gg  ucu ggauugggcac  uaaau u
u    cu   c   ga  gu   c           -c     u 

Deep sequencing

12325 reads, 37 experiments

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human BC-1 cells [2].

Genome context

• Coordinates (GRCh37.p5): chr11: 121970465-121970552 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000387639 ; RP11-166D19.1-016; intron 1

  OTTHUMT00000387640 ; RP11-166D19.1-015; intron 1

  OTTHUMT00000387641 ; RP11-166D19.1-004; intron 1

  OTTHUMT00000387643 ; RP11-166D19.1-001; intron 1

  OTTHUMT00000387645 ; RP11-166D19.1-003; intron 1

  OTTHUMT00000387647 ; RP11-166D19.1-002; intron 1

  OTTHUMT00000387649 ; RP11-166D19.1-010; intron 1

  OTTHUMT00000387651 ; RP11-166D19.1-009; intron 1

  OTTHUMT00000387652 ; RP11-166D19.1-008; intron 1

  OTTHUMT00000387639 ; RP11-166D19.1-017; intron 1

  OTTHUMT00000387640 ; RP11-166D19.1-015; intron 1

  OTTHUMT00000387641 ; RP11-166D19.1-004; intron 1

  OTTHUMT00000387643 ; RP11-166D19.1-001; intron 1

  OTTHUMT00000387645 ; RP11-166D19.1-003; intron 1

  OTTHUMT00000387647 ; RP11-166D19.1-002; intron 1

  OTTHUMT00000387649 ; RP11-166D19.1-010; intron 1

  OTTHUMT00000387651 ; RP11-166D19.1-009; intron 1

  OTTHUMT00000387652 ; RP11-166D19.1-008; intron 1

  OTTHUMT00000387639 ; RP11-166D19.1-017; intron 1

  OTTHUMT00000387640 ; RP11-166D19.1-015; intron 1

  OTTHUMT00000387641 ; RP11-166D19.1-004; intron 1

  OTTHUMT00000387643 ; RP11-166D19.1-001; intron 1

  OTTHUMT00000387645 ; RP11-166D19.1-003; intron 1

  OTTHUMT00000387647 ; RP11-166D19.1-002; intron 1

  OTTHUMT00000387649 ; RP11-166D19.1-010; intron 1

  OTTHUMT00000387651 ; RP11-166D19.1-009; intron 1

  OTTHUMT00000387652 ; RP11-166D19.1-008; intron 1

  OTTHUMT00000387648 ; RP11-166D19.1-011; intron 2

  OTTHUMT00000387650 ; RP11-166D19.1-012; intron 2

  OTTHUMT00000387648 ; RP11-166D19.1-011; intron 2

  OTTHUMT00000387650 ; RP11-166D19.1-012; intron 2

  OTTHUMT00000387648 ; RP11-166D19.1-011; intron 2

  OTTHUMT00000387650 ; RP11-166D19.1-012; intron 2

  ENST00000530955 ; RP11-166D19.1-016; intron 1

  ENST00000532319 ; RP11-166D19.1-015; intron 1

  ENST00000531381 ; RP11-166D19.1-004; intron 1

  ENST00000529823 ; RP11-166D19.1-001; intron 1

  ENST00000524376 ; RP11-166D19.1-003; intron 1

  ENST00000528986 ; RP11-166D19.1-002; intron 1

  ENST00000534195 ; RP11-166D19.1-010; intron 1

  ENST00000532315 ; RP11-166D19.1-009; intron 1

  ENST00000534297 ; RP11-166D19.1-008; intron 1

  ENST00000530955 ; RP11-166D19.1-017; intron 1

  ENST00000532319 ; RP11-166D19.1-015; intron 1

  ENST00000531381 ; RP11-166D19.1-004; intron 1

  ENST00000529823 ; RP11-166D19.1-001; intron 1

  ENST00000524376 ; RP11-166D19.1-003; intron 1

  ENST00000528986 ; RP11-166D19.1-002; intron 1

  ENST00000534195 ; RP11-166D19.1-010; intron 1

  ENST00000532315 ; RP11-166D19.1-009; intron 1

  ENST00000534297 ; RP11-166D19.1-008; intron 1

  ENST00000530955 ; RP11-166D19.1-017; intron 1

  ENST00000532319 ; RP11-166D19.1-015; intron 1

  ENST00000531381 ; RP11-166D19.1-004; intron 1

  ENST00000529823 ; RP11-166D19.1-001; intron 1

  ENST00000524376 ; RP11-166D19.1-003; intron 1

  ENST00000528986 ; RP11-166D19.1-002; intron 1

  ENST00000534195 ; RP11-166D19.1-010; intron 1

  ENST00000532315 ; RP11-166D19.1-009; intron 1

  ENST00000534297 ; RP11-166D19.1-008; intron 1

  ENST00000531071 ; RP11-166D19.1-011; intron 2

  ENST00000532890 ; RP11-166D19.1-012; intron 2

  ENST00000531071 ; RP11-166D19.1-011; intron 2

  ENST00000532890 ; RP11-166D19.1-012; intron 2

  ENST00000531071 ; RP11-166D19.1-011; intron 2

  ENST00000532890 ; RP11-166D19.1-012; intron 2

Database links

• ENTREZGENE: 406911;MIR125B1
• HGNC: 31506;MIR125B1

Mature sequence hsa-miR-125b-5p

• Accession: MIMAT0000423
• Previous IDs: hsa-miR-125b
• Sequence: 15 - ucccugagacccuaacuuguga - 36
• Deep sequencing: 23617 reads, 38 experiments
• Evidence: experimental; cloned [2,4-6], Solexa [7]
• Validated targets:
  • TARBASE:hsa-miR-125b-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-125b-5p
  • MICRORNA.ORG:hsa-miR-125b-5p
  • MIRDB:hsa-miR-125b-5p
  • RNA22-HSA:hsa-miR-125b-5p
  • TARGETMINER:hsa-miR-125b-5p
  • TARGETSCAN-VERT:hsa-miR-125b
  • PICTAR-VERT:hsa-miR-125b

Mature sequence hsa-miR-125b-1-3p

• Accession: MIMAT0004592
• Previous IDs: hsa-miR-125b-1*
• Sequence: 55 - acggguuaggcucuugggagcu - 76
• Deep sequencing: 544 reads, 18 experiments
• Evidence: experimental; cloned [5]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-125b-1-3p
  • MICRORNA.ORG:hsa-miR-125b-1-3p
  • MIRDB:hsa-miR-125b-1-3p
  • RNA22-HSA:hsa-miR-125b-1-3p
  • TARGETMINER:hsa-miR-125b-1-3p
  • PICTAR-VERT:hsa-miR-125b

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
3. PMID:15722555 "Depletion of human micro-RNA miR-125b reveals that it is critical for the proliferation of differentiated cells but not for the down-regulation of putative targets during differentiation" Lee YS, Kim HK, Chung S, Kim KS, Dutta A J Biol Chem. 280:16635-16641(2005).
4. PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
5. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
7. PMID:20158877 "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).