Stem-loop sequence hsa-mir-125b-1

AccessionMI0000446 (change log)
Symbol HGNC:MIR125B1
DescriptionHomo sapiens miR-125b-1 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   u    uc   u   uc  ug   c           au     c 
5'  gcgc  cuc cag  cc  aga ccuaacuugug  guuua c
    ||||  ||| |||  ||  ||| |||||||||||  ||||| g
3'  cgug  gag guc  gg  ucu ggauugggcac  uaaau u
   u    cu   c   ga  gu   c           -c     u 
Get sequence
Deep sequencing
468336 reads, 1.19e+04 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human BC-1 cells [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 122099757-122099844 [-]
sense
OTTHUMT00000387568 ; RP11-820L6.1-006; intron 2
OTTHUMT00000387569 ; RP11-820L6.1-008; intron 2
OTTHUMT00000387551 ; RP11-820L6.1-001; intron 3
ENST00000529804 ; RP11-820L6.1-006; intron 2
ENST00000529733 ; RP11-820L6.1-008; intron 2
ENST00000527474 ; RP11-820L6.1-001; intron 3
Database links

Mature sequence hsa-miR-125b-5p

Accession MIMAT0000423
Previous IDshsa-miR-125b
Sequence

15 - 

ucccugagacccuaacuuguga

 - 36

Get sequence
Deep sequencing932867 reads, 77 experiments
Evidence experimental; cloned [2,4-6], Illumina [7]
Database links
Predicted targets

Mature sequence hsa-miR-125b-1-3p

Accession MIMAT0004592
Previous IDshsa-miR-125b-1*
Sequence

55 - 

acggguuaggcucuugggagcu

 - 76

Get sequence
Deep sequencing1862 reads, 51 experiments
Evidence experimental; cloned [5]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
3
4
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
7