Stem-loop sequence hsa-mir-124-3

AccessionMI0000445 (change log)
Previous IDshsa-mir-124a-3
Symbol HGNC:MIR124-3
DescriptionHomo sapiens miR-124-3 stem-loop
Gene family MIPF0000021; mir-124
Literature search

423 open access papers mention hsa-mir-124-3
(3647 sentences)

Stem-loop
   u    -   c    - c        a   ga        uaaug 
5'  gagg gcc cucu g guguucac gcg  ccuugauu     u
    |||| ||| |||| | |||||||| |||  ||||||||      
3'  cucc cgg gaga c cguaagug cgc  ggaauuaa     c
   c    g   a    a -        g   ac        cauau 
Get sequence
Deep sequencing
132544 reads, 257 reads per million, 106 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-124 was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 63178500-63178586 [+]
intergenic
Database links

Mature sequence hsa-miR-124-5p

Accession MIMAT0004591
Previous IDshsa-miR-124*
Sequence

15 - 

cguguucacagcggaccuugau

 - 36

Get sequence
Deep sequencing4370 reads, 22 experiments
Evidence experimental; cloned [5]
Predicted targets

Mature sequence hsa-miR-124-3p

Accession MIMAT0000422
Previous IDshsa-miR-124a;hsa-miR-124
Sequence

53 - 

uaaggcacgcggugaaugccaa

 - 74

Get sequence
Deep sequencing393261 reads, 104 experiments
Evidence experimental; cloned [2,4-5]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).