Stem-loop sequence hsa-mir-124-3

Accession MI0000445
Previous IDs hsa-mir-124a-3
Symbol HGNC:MIR124-3
Description Homo sapiens miR-124-3 stem-loop
Gene family MIPF0000021; mir-124
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation.. However the topic result quite controversial since different reports described also a role for miR-124 during neuronal differentiation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u    -   c    - c        a   ga        uaaug 
 gagg gcc cucu g guguucac gcg  ccuugauu     u
 |||| ||| |||| | |||||||| |||  ||||||||      
 cucc cgg gaga c cguaagug cgc  ggaauuaa     c
c    g   a    a -        g   ac        cauau 
Get sequence
Deep sequencing
400 reads, 12 experiments
Comments

miR-124 was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr20: 61809852-61809938 [+]
antisense
OTTHUMT00000276288 ; RP5-963E22.4-001; intron 1
OTTHUMT00000276288 ; RP5-963E22.4-001; intron 1
OTTHUMT00000276288 ; RP5-963E22.4-001; intron 1
ENST00000423020 ; RP5-963E22.4-001; intron 1
ENST00000423020 ; RP5-963E22.4-001; intron 1
ENST00000423020 ; RP5-963E22.4-001; intron 1
Database links

Mature sequence hsa-miR-124-5p

Accession MIMAT0004591
Previous IDs hsa-miR-124*
Sequence

15 - 

cguguucacagcggaccuugau

 - 36

Get sequence
Evidence experimental; cloned [5]
Predicted targets

Mature sequence hsa-miR-124-3p

Accession MIMAT0000422
Previous IDs hsa-miR-124a;hsa-miR-124
Sequence

53 - 

uaaggcacgcggugaaugcc

 - 72

Get sequence
Deep sequencing 854 reads, 13 experiments
Evidence experimental; cloned [2,4-5]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).