Stem-loop sequence hsa-mir-122

Accession MI0000442
Previous IDs hsa-mir-122a
Symbol HGNC:MIR122
Description Homo sapiens miR-122 stem-loop
Gene family MIPF0000095; mir-122
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-122. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-122 is a miRNA that is conserved between vertebrate species. miR-122 is not present in invertebrates, and no close paralogs of miR-122 have been detected. miR-122 expression is specific to the liver, where it has been implicated as a regulator of fatty-acid metabolism in mouse studies. Reduced miR-122 levels are associated with hepatocellular carcinoma. miR-122 also plays an important positive role in the regulation of hepatitis C virus replication.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c        -      gg       c           --u  c 
 cuuagcag agcugu  aguguga aaugguguuug   gu u
 |||||||| ||||||  ||||||| |||||||||||   ||  
 ggaucguc ucgaua  ucacacu uuaccgcaaac   ca a
c        a      aa       a           uau  a 
Get sequence
Deep sequencing
381 reads, 16 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr18: 56118306-56118390 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-122
hsa-mir-122 chr18: 56118306-56118390 [+]
hsa-mir-3591 chr18: 56118312-56118384 [-]
Database links

Mature sequence hsa-miR-122-5p

Accession MIMAT0000421
Previous IDs hsa-miR-122a;hsa-miR-122
Sequence

15 - 

uggagugugacaaugguguuug

 - 36

Get sequence
Deep sequencing 381 reads, 16 experiments
Evidence experimental; cloned [2-3], Northern [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-122-3p

Accession MIMAT0004590
Previous IDs hsa-miR-122*
Sequence

51 - 

aacgccauuaucacacuaaaua

 - 72

Get sequence
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).