Stem-loop sequence hsa-mir-30b

Accession MI0000441
Symbol HGNC:MIR30B
Description Homo sapiens miR-30b stem-loop
Gene family MIPF0000005; mir-30
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-30_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30) and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs. Members of the miR-30 family have been found to be highly expressed in heart cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
a     uu      cau          u  -a        uaaua 
 ccaag  ucaguu   guaaacaucc ac  cucagcug     c
 |||||  ||||||   |||||||||| ||  ||||||||      
 gguuc  agucga   cauuuguagg ug  gggucggu     a
a     --      cuu          -  ga        uaggu 
Get sequence
Deep sequencing
3785 reads, 37 experiments
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr8: 135812763-135812850 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-30b
hsa-mir-30d chr8: 135817119-135817188 [-]
hsa-mir-30b chr8: 135812763-135812850 [-]
Database links

Mature sequence hsa-miR-30b-5p

Accession MIMAT0000420
Previous IDs hsa-miR-30b
Sequence

17 - 

uguaaacauccuacacucagcu

 - 38

Get sequence
Deep sequencing 3246 reads, 28 experiments
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

Mature sequence hsa-miR-30b-3p

Accession MIMAT0004589
Previous IDs hsa-miR-30b*
Sequence

55 - 

cugggagguggauguuuacuuc

 - 76

Get sequence
Deep sequencing 539 reads, 21 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).