Stem-loop sequence hsa-mir-27b

Accession

MI0000440 (change log)

Symbol

HGNC:MIR27B

Description

Homo sapiens miR-27b stem-loop

Gene family

MIPF0000036; mir-27

Literature search

301 open access papers mention hsa-mir-27b
(1245 sentences)

Stem-loop

   -    -    aaca                  auug        ugau     
5'  accu cucu    aggugcagagcuuagcug    gugaacag    uggu 
    |||| ||||    ||||||||||||||||||    ||||||||    ||| u
3'  ugga gaga    uccacgucuugaaucggu    cacuuguu    gccu 
   g    a    --ag                  --ga        --uc     

Deep sequencing

5215824 reads, 1.49e+04 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Lagos-Quintana et al. determined the expression of miR-27b in mouse [1] - a human sequence was predicted based on homology. Michael et al. subsequently verified the expression of this miRNA in human cells [2].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr9: 95085445-95085541 [+]
• Overlapping transcripts:

  antisense

  OTTHUMT00000053082 ; NOL8-010; intron 2

  OTTHUMT00000053080 ; NOL8-008; intron 2

  OTTHUMT00000402688 ; NOL8-020; intron 2

  OTTHUMT00000053078 ; NOL8-006; intron 3

  OTTHUMT00000402684 ; NOL8-015; intron 3

  OTTHUMT00000053075 ; NOL8-003; intron 3

  OTTHUMT00000402685 ; NOL8-017; intron 3

  OTTHUMT00000053076 ; NOL8-004; intron 3

  OTTHUMT00000402687 ; NOL8-013; intron 3

  OTTHUMT00000053079 ; NOL8-007; intron 3

  OTTHUMT00000402693 ; NOL8-028; intron 3

  OTTHUMT00000402689 ; NOL8-018; intron 3

  OTTHUMT00000402690 ; NOL8-019; intron 3

  OTTHUMT00000402695 ; NOL8-024; intron 3

  OTTHUMT00000402697 ; NOL8-022; intron 3

  OTTHUMT00000402698 ; NOL8-023; exon 3

  OTTHUMT00000402682 ; NOL8-012; intron 4

  OTTHUMT00000402683 ; NOL8-016; intron 4

  OTTHUMT00000053077 ; NOL8-005; intron 4

  OTTHUMT00000402691 ; NOL8-027; intron 4

  OTTHUMT00000402692 ; NOL8-025; intron 4

  OTTHUMT00000402694 ; NOL8-026; intron 4

  OTTHUMT00000402696 ; NOL8-021; intron 4

  OTTHUMT00000053074 ; NOL8-002; exon 4

  ENST00000535387 ; NOL8-010; intron 2

  ENST00000542053 ; NOL8-008; intron 2

  ENST00000411621 ; NOL8-020; intron 2

  ENST00000442668 ; NOL8-006; intron 3

  ENST00000545558 ; NOL8-015; intron 3

  ENST00000360868 ; NOL8-003; intron 3

  ENST00000544867 ; NOL8-017; intron 3

  ENST00000432670 ; NOL8-004; intron 3

  ENST00000433029 ; NOL8-013; intron 3

  ENST00000421075 ; NOL8-007; intron 3

  ENST00000445919 ; NOL8-028; intron 3

  ENST00000535807 ; NOL8-018; intron 3

  ENST00000536624 ; NOL8-019; intron 3

  ENST00000543985 ; NOL8-024; intron 3

  ENST00000538215 ; NOL8-022; intron 3

  ENST00000535649 ; NOL8-023; exon 3

  ENST00000545444 ; NOL8-012; intron 4

  ENST00000536593 ; NOL8-016; intron 4

  ENST00000434228 ; NOL8-005; intron 4

  ENST00000542613 ; NOL8-027; intron 4

  ENST00000542573 ; NOL8-025; intron 4

  ENST00000543260 ; NOL8-026; intron 4

  ENST00000544321 ; NOL8-021; intron 4

  ENST00000482475 ; NOL8-002; exon 4

  ENST00000358855 ; NOL8-201; intron 4

Clustered miRNAs

< 10kb from hsa-mir-27b

• hsa-mir-23b: chr9: 95085208-95085304 [+]
• hsa-mir-27b: chr9: 95085445-95085541 [+]
• hsa-mir-3074: chr9: 95086014-95086094 [-]
• hsa-mir-24-1: chr9: 95086021-95086088 [+]

Database links

• EntrezGene:MIR27B
• HGNC:MIR27B
• RNAcentral:URS000075B0A5_9606
• miRBase Tracker:MI0000440

Mature sequence hsa-miR-27b-5p

• Accession: MIMAT0004588
• Previous IDs: hsa-miR-27b*
• Sequence: 19 - agagcuuagcugauuggugaac - 40
• Deep sequencing: 64601 reads, 157 experiments
• Evidence: experimental; cloned [4-5]
• Database links:
  • RNAcentral:URS0000330617_9606
• Predicted targets:
  • TargetMiner:hsa-miR-27b-5p
  • TargetScanVert:hsa-miR-27b-5p
  • miRDB:hsa-miR-27b-5p
  • microrna.org:hsa-miR-27b-5p

Mature sequence hsa-miR-27b-3p

• Accession: MIMAT0000419
• Previous IDs: hsa-miR-27b
• Sequence: 61 - uucacaguggcuaaguucugc - 81
• Deep sequencing: 5151080 reads, 159 experiments
• Evidence: experimental; cloned [2-5]
• Database links:
  • RNAcentral:URS000059311D_9606
• Predicted targets:
  • TargetMiner:hsa-miR-27b-3p
  • TargetScanVert:hsa-miR-27b-3p
  • miRDB:hsa-miR-27b-3p
  • microrna.org:hsa-miR-27b-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3. PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).