![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-27b |
||||||||||
Accession | MI0000440 (change log) | |||||||||
Symbol | HGNC:MIR27B | |||||||||
Description | Homo sapiens miR-27b stem-loop | |||||||||
Gene family | MIPF0000036; mir-27 | |||||||||
Literature search |
![]()
301 open access papers mention hsa-mir-27b | |||||||||
Stem-loop |
- - aaca auug ugau 5' accu cucu aggugcagagcuuagcug gugaacag uggu |||| |||| |||||||||||||||||| |||||||| ||| u 3' ugga gaga uccacgucuugaaucggu cacuuguu gccu g a --ag --ga --uc |
|||||||||
Deep sequencing |
| |||||||||
Confidence |
Annotation confidence: high
| |||||||||
Comments |
Lagos-Quintana et al. determined the expression of miR-27b in mouse [1] - a human sequence was predicted based on homology. Michael et al. subsequently verified the expression of this miRNA in human cells [2]. |
|||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
|
Mature sequence hsa-miR-27b-5p |
|
Accession | MIMAT0004588 |
Previous IDs | hsa-miR-27b* |
Sequence |
19 - agagcuuagcugauuggugaac - 40 |
Deep sequencing | 64601 reads, 157 experiments |
Evidence | experimental; cloned [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-27b-3p |
|
Accession | MIMAT0000419 |
Previous IDs | hsa-miR-27b |
Sequence |
61 - uucacaguggcuaaguucugc - 81 |
Deep sequencing | 5151080 reads, 159 experiments |
Evidence | experimental; cloned [2-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:14573789
"Reduced accumulation of specific microRNAs in colorectal neoplasia"
Mol Cancer Res. 1:882-891(2003).
|
3 |
PMID:12554860
"Numerous microRNPs in neuronal cells containing novel microRNAs"
RNA. 9:180-186(2003).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|