Stem-loop sequence hsa-mir-27b

Accession MI0000440
Symbol HGNC:MIR27B
Description Homo sapiens miR-27b stem-loop
Gene family MIPF0000036; mir-27
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-27. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-27 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-27 precursor is the microRNA mir-27. Herpesvirus saimiri expresses several non-coding RNAs (HSURs) which have been found to significantly reduce the level of mir-27 in a host cell. It has been proposed that miR-27 operates together with miR-23 and mir-24 in a co-operative cluster.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-    -    aaca                  auug        ugau     
 accu cucu    aggugcagagcuuagcug    gugaacag    uggu 
 |||| ||||    ||||||||||||||||||    ||||||||    ||| u
 ugga gaga    uccacgucuugaaucggu    cacuuguu    gccu 
g    a    --ag                  --ga        --uc     
Get sequence
Deep sequencing
27013 reads, 64 experiments
Comments

Lagos-Quintana et al. determined the expression of miR-27b in mouse [1] - a human sequence was predicted based on homology. Michael et al. subsequently verified the expression of this miRNA in human cells [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr9: 97847727-97847823 [+]
sense
OTTHUMT00000053202 ; C9orf3-007; intron 4
OTTHUMT00000053202 ; C9orf3-007; intron 4
OTTHUMT00000053202 ; C9orf3-007; intron 4
OTTHUMT00000053196 ; C9orf3-001; intron 5
OTTHUMT00000053209 ; C9orf3-014; intron 5
OTTHUMT00000053196 ; C9orf3-001; intron 5
OTTHUMT00000053209 ; C9orf3-014; intron 5
OTTHUMT00000053196 ; C9orf3-001; intron 5
OTTHUMT00000053209 ; C9orf3-014; intron 5
OTTHUMT00000053211 ; C9orf3-016; intron 6
OTTHUMT00000053211 ; C9orf3-016; intron 6
OTTHUMT00000053211 ; C9orf3-016; intron 6
OTTHUMT00000053197 ; C9orf3-002; intron 14
OTTHUMT00000053197 ; C9orf3-002; intron 14
OTTHUMT00000053197 ; C9orf3-002; intron 14
OTTHUMT00000053203 ; C9orf3-008; intron 15
OTTHUMT00000053203 ; C9orf3-008; intron 15
OTTHUMT00000053203 ; C9orf3-008; intron 15
ENST00000468164 ; C9orf3-007; intron 4
ENST00000468164 ; C9orf3-007; intron 4
ENST00000468164 ; C9orf3-007; intron 4
ENST00000471978 ; C9orf3-014; intron 5
ENST00000463372 ; C9orf3-001; intron 5
ENST00000471978 ; C9orf3-014; intron 5
ENST00000463372 ; C9orf3-001; intron 5
ENST00000471978 ; C9orf3-014; intron 5
ENST00000463372 ; C9orf3-001; intron 5
ENST00000478473 ; C9orf3-016; intron 6
ENST00000375314 ; C9orf3-201; intron 6
ENST00000478473 ; C9orf3-016; intron 6
ENST00000375314 ; C9orf3-201; intron 6
ENST00000478473 ; C9orf3-016; intron 6
ENST00000297979 ; C9orf3-002; intron 14
ENST00000297979 ; C9orf3-002; intron 14
ENST00000297979 ; C9orf3-002; intron 14
ENST00000428313 ; C9orf3-008; intron 15
ENST00000375315 ; C9orf3-202; intron 15
ENST00000428313 ; C9orf3-008; intron 15
ENST00000375315 ; C9orf3-202; intron 15
ENST00000428313 ; C9orf3-008; intron 15
ENST00000375315 ; C9orf3-201; intron 15
Clustered miRNAs
< 10kb from hsa-mir-27b
hsa-mir-23b chr9: 97847490-97847586 [+]
hsa-mir-27b chr9: 97847727-97847823 [+]
hsa-mir-3074 chr9: 97848296-97848376 [-]
hsa-mir-24-1 chr9: 97848303-97848370 [+]
Database links

Mature sequence hsa-miR-27b-5p

Accession MIMAT0004588
Previous IDs hsa-miR-27b*
Sequence

19 - 

agagcuuagcugauuggugaac

 - 40

Get sequence
Deep sequencing 1200 reads, 26 experiments
Evidence experimental; cloned [4-5]
Predicted targets

Mature sequence hsa-miR-27b-3p

Accession MIMAT0000419
Previous IDs hsa-miR-27b
Sequence

61 - 

uucacaguggcuaaguucugc

 - 81

Get sequence
Deep sequencing 25808 reads, 54 experiments
Evidence experimental; cloned [2-5]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).