Stem-loop sequence hsa-mir-27b

AccessionMI0000440
Symbol HGNC:MIR27B
DescriptionHomo sapiens miR-27b stem-loop
Gene family MIPF0000036; mir-27
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-27. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-27 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-27 precursor is the microRNA mir-27. Herpesvirus saimiri expresses several non-coding RNAs (HSURs) which have been found to significantly reduce the level of mir-27 in a host cell. It has been proposed that miR-27 operates together with miR-23 and mir-24 in a co-operative cluster.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -    -    aaca                  auug        ugau     
5'  accu cucu    aggugcagagcuuagcug    gugaacag    uggu 
    |||| ||||    ||||||||||||||||||    ||||||||    ||| u
3'  ugga gaga    uccacgucuugaaucggu    cacuuguu    gccu 
   g    a    --ag                  --ga        --uc     
Get sequence
Deep sequencing
372686 reads, 1.02e+04 reads per million, 80 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Lagos-Quintana et al. determined the expression of miR-27b in mouse [1] - a human sequence was predicted based on homology. Michael et al. subsequently verified the expression of this miRNA in human cells [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr9: 95085445-95085541 [+]
antisense
OTTHUMT00000053082 ; NOL8-010; intron 2
OTTHUMT00000053080 ; NOL8-008; intron 2
OTTHUMT00000402688 ; NOL8-020; intron 2
OTTHUMT00000053078 ; NOL8-006; intron 3
OTTHUMT00000402684 ; NOL8-015; intron 3
OTTHUMT00000053075 ; NOL8-003; intron 3
OTTHUMT00000402685 ; NOL8-017; intron 3
OTTHUMT00000053076 ; NOL8-004; intron 3
OTTHUMT00000402687 ; NOL8-013; intron 3
OTTHUMT00000053079 ; NOL8-007; intron 3
OTTHUMT00000402693 ; NOL8-028; intron 3
OTTHUMT00000402689 ; NOL8-018; intron 3
OTTHUMT00000402690 ; NOL8-019; intron 3
OTTHUMT00000402695 ; NOL8-024; intron 3
OTTHUMT00000402697 ; NOL8-022; intron 3
OTTHUMT00000402698 ; NOL8-023; exon 3
OTTHUMT00000402682 ; NOL8-012; intron 4
OTTHUMT00000402683 ; NOL8-016; intron 4
OTTHUMT00000053077 ; NOL8-005; intron 4
OTTHUMT00000402691 ; NOL8-027; intron 4
OTTHUMT00000402692 ; NOL8-025; intron 4
OTTHUMT00000402694 ; NOL8-026; intron 4
OTTHUMT00000402696 ; NOL8-021; intron 4
OTTHUMT00000053074 ; NOL8-002; exon 4
ENST00000535387 ; NOL8-010; intron 2
ENST00000542053 ; NOL8-008; intron 2
ENST00000411621 ; NOL8-020; intron 2
ENST00000442668 ; NOL8-006; intron 3
ENST00000545558 ; NOL8-015; intron 3
ENST00000360868 ; NOL8-003; intron 3
ENST00000544867 ; NOL8-017; intron 3
ENST00000432670 ; NOL8-004; intron 3
ENST00000433029 ; NOL8-013; intron 3
ENST00000421075 ; NOL8-007; intron 3
ENST00000445919 ; NOL8-028; intron 3
ENST00000535807 ; NOL8-018; intron 3
ENST00000536624 ; NOL8-019; intron 3
ENST00000543985 ; NOL8-024; intron 3
ENST00000538215 ; NOL8-022; intron 3
ENST00000535649 ; NOL8-023; exon 3
ENST00000545444 ; NOL8-012; intron 4
ENST00000536593 ; NOL8-016; intron 4
ENST00000434228 ; NOL8-005; intron 4
ENST00000542613 ; NOL8-027; intron 4
ENST00000542573 ; NOL8-025; intron 4
ENST00000543260 ; NOL8-026; intron 4
ENST00000544321 ; NOL8-021; intron 4
ENST00000482475 ; NOL8-002; exon 4
ENST00000358855 ; NOL8-201; intron 4
Clustered miRNAs
< 10kb from hsa-mir-27b
hsa-mir-23bchr9: 95085208-95085304 [+]
hsa-mir-27bchr9: 95085445-95085541 [+]
hsa-mir-3074chr9: 95086014-95086094 [-]
hsa-mir-24-1chr9: 95086021-95086088 [+]
Database links

Mature sequence hsa-miR-27b-5p

Accession MIMAT0004588
Previous IDshsa-miR-27b*
Sequence

19 - 

agagcuuagcugauuggugaac

 - 40

Get sequence
Deep sequencing3450 reads, 61 experiments
Evidence experimental; cloned [4-5]
Predicted targets

Mature sequence hsa-miR-27b-3p

Accession MIMAT0000419
Previous IDshsa-miR-27b
Sequence

61 - 

uucacaguggcuaaguucugc

 - 81

Get sequence
Deep sequencing2299 reads, 65 experiments
Evidence experimental; cloned [2-5]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).