Stem-loop sequence hsa-mir-27b

AccessionMI0000440 (change log)
Symbol HGNC:MIR27B
DescriptionHomo sapiens miR-27b stem-loop
Gene family MIPF0000036; mir-27
Literature search

301 open access papers mention hsa-mir-27b
(1245 sentences)

Stem-loop
   -    -    aaca                  auug        ugau     
5'  accu cucu    aggugcagagcuuagcug    gugaacag    uggu 
    |||| ||||    ||||||||||||||||||    ||||||||    ||| u
3'  ugga gaga    uccacgucuugaaucggu    cacuuguu    gccu 
   g    a    --ag                  --ga        --uc     
Get sequence
Deep sequencing
5215824 reads, 1.49e+04 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Lagos-Quintana et al. determined the expression of miR-27b in mouse [1] - a human sequence was predicted based on homology. Michael et al. subsequently verified the expression of this miRNA in human cells [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 95085445-95085541 [+]
antisense
OTTHUMT00000053082 ; NOL8-010; intron 2
OTTHUMT00000053080 ; NOL8-008; intron 2
OTTHUMT00000402688 ; NOL8-020; intron 2
OTTHUMT00000053078 ; NOL8-006; intron 3
OTTHUMT00000402684 ; NOL8-015; intron 3
OTTHUMT00000053075 ; NOL8-003; intron 3
OTTHUMT00000402685 ; NOL8-017; intron 3
OTTHUMT00000053076 ; NOL8-004; intron 3
OTTHUMT00000402687 ; NOL8-013; intron 3
OTTHUMT00000053079 ; NOL8-007; intron 3
OTTHUMT00000402693 ; NOL8-028; intron 3
OTTHUMT00000402689 ; NOL8-018; intron 3
OTTHUMT00000402690 ; NOL8-019; intron 3
OTTHUMT00000402695 ; NOL8-024; intron 3
OTTHUMT00000402697 ; NOL8-022; intron 3
OTTHUMT00000402698 ; NOL8-023; exon 3
OTTHUMT00000402682 ; NOL8-012; intron 4
OTTHUMT00000402683 ; NOL8-016; intron 4
OTTHUMT00000053077 ; NOL8-005; intron 4
OTTHUMT00000402691 ; NOL8-027; intron 4
OTTHUMT00000402692 ; NOL8-025; intron 4
OTTHUMT00000402694 ; NOL8-026; intron 4
OTTHUMT00000402696 ; NOL8-021; intron 4
OTTHUMT00000053074 ; NOL8-002; exon 4
ENST00000535387 ; NOL8-010; intron 2
ENST00000542053 ; NOL8-008; intron 2
ENST00000411621 ; NOL8-020; intron 2
ENST00000442668 ; NOL8-006; intron 3
ENST00000545558 ; NOL8-015; intron 3
ENST00000360868 ; NOL8-003; intron 3
ENST00000544867 ; NOL8-017; intron 3
ENST00000432670 ; NOL8-004; intron 3
ENST00000433029 ; NOL8-013; intron 3
ENST00000421075 ; NOL8-007; intron 3
ENST00000445919 ; NOL8-028; intron 3
ENST00000535807 ; NOL8-018; intron 3
ENST00000536624 ; NOL8-019; intron 3
ENST00000543985 ; NOL8-024; intron 3
ENST00000538215 ; NOL8-022; intron 3
ENST00000535649 ; NOL8-023; exon 3
ENST00000545444 ; NOL8-012; intron 4
ENST00000536593 ; NOL8-016; intron 4
ENST00000434228 ; NOL8-005; intron 4
ENST00000542613 ; NOL8-027; intron 4
ENST00000542573 ; NOL8-025; intron 4
ENST00000543260 ; NOL8-026; intron 4
ENST00000544321 ; NOL8-021; intron 4
ENST00000482475 ; NOL8-002; exon 4
ENST00000358855 ; NOL8-201; intron 4
Clustered miRNAs
< 10kb from hsa-mir-27b
hsa-mir-23bchr9: 95085208-95085304 [+]
hsa-mir-27bchr9: 95085445-95085541 [+]
hsa-mir-3074chr9: 95086014-95086094 [-]
hsa-mir-24-1chr9: 95086021-95086088 [+]
Database links

Mature sequence hsa-miR-27b-5p

Accession MIMAT0004588
Previous IDshsa-miR-27b*
Sequence

19 - 

agagcuuagcugauuggugaac

 - 40

Get sequence
Deep sequencing64601 reads, 157 experiments
Evidence experimental; cloned [4-5]
Database links
Predicted targets

Mature sequence hsa-miR-27b-3p

Accession MIMAT0000419
Previous IDshsa-miR-27b
Sequence

61 - 

uucacaguggcuaaguucugc

 - 81

Get sequence
Deep sequencing5151080 reads, 159 experiments
Evidence experimental; cloned [2-5]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).