Stem-loop sequence hsa-mir-23b

Accession

MI0000439

Symbol

HGNC:MIR23B

Description

Homo sapiens miR-23b stem-loop

Gene family

MIPF0000027; mir-23

Stem-loop

c     u c  -   c   u   --          -  c      gugacu 
 ucagg g uc ugg ugc ugg  guuccuggca ug ugauuu      u
 ||||| | || ||| ||| |||  |||||||||| || ||||||       
 gguuc c ag acc acg acc  uagggaccgu ac acuaaa      a
c     - -  c   a   c   au          u  -      auuaga 

Deep sequencing

112201 reads, 46 experiments

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context

• Coordinates (GRCh37.p5): chr9: 97847490-97847586 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000053202 ; C9orf3-007; intron 4

  OTTHUMT00000053202 ; C9orf3-007; intron 4

  OTTHUMT00000053202 ; C9orf3-007; intron 4

  OTTHUMT00000053196 ; C9orf3-001; intron 5

  OTTHUMT00000053209 ; C9orf3-014; intron 5

  OTTHUMT00000053196 ; C9orf3-001; intron 5

  OTTHUMT00000053209 ; C9orf3-014; intron 5

  OTTHUMT00000053196 ; C9orf3-001; intron 5

  OTTHUMT00000053209 ; C9orf3-014; intron 5

  OTTHUMT00000053211 ; C9orf3-016; intron 6

  OTTHUMT00000053211 ; C9orf3-016; intron 6

  OTTHUMT00000053211 ; C9orf3-016; intron 6

  OTTHUMT00000053197 ; C9orf3-002; intron 14

  OTTHUMT00000053197 ; C9orf3-002; intron 14

  OTTHUMT00000053197 ; C9orf3-002; intron 14

  OTTHUMT00000053203 ; C9orf3-008; intron 15

  OTTHUMT00000053203 ; C9orf3-008; intron 15

  OTTHUMT00000053203 ; C9orf3-008; intron 15

  ENST00000468164 ; C9orf3-007; intron 4

  ENST00000468164 ; C9orf3-007; intron 4

  ENST00000468164 ; C9orf3-007; intron 4

  ENST00000471978 ; C9orf3-014; intron 5

  ENST00000463372 ; C9orf3-001; intron 5

  ENST00000471978 ; C9orf3-014; intron 5

  ENST00000463372 ; C9orf3-001; intron 5

  ENST00000471978 ; C9orf3-014; intron 5

  ENST00000463372 ; C9orf3-001; intron 5

  ENST00000478473 ; C9orf3-016; intron 6

  ENST00000375314 ; C9orf3-201; intron 6

  ENST00000478473 ; C9orf3-016; intron 6

  ENST00000375314 ; C9orf3-201; intron 6

  ENST00000478473 ; C9orf3-016; intron 6

  ENST00000297979 ; C9orf3-002; intron 14

  ENST00000297979 ; C9orf3-002; intron 14

  ENST00000297979 ; C9orf3-002; intron 14

  ENST00000428313 ; C9orf3-008; intron 15

  ENST00000375315 ; C9orf3-202; intron 15

  ENST00000428313 ; C9orf3-008; intron 15

  ENST00000375315 ; C9orf3-202; intron 15

  ENST00000428313 ; C9orf3-008; intron 15

  ENST00000375315 ; C9orf3-201; intron 15

Clustered miRNAs

< 10kb from hsa-mir-23b

• hsa-mir-23b: chr9: 97847490-97847586 [+]
• hsa-mir-27b: chr9: 97847727-97847823 [+]
• hsa-mir-3074: chr9: 97848296-97848376 [-]
• hsa-mir-24-1: chr9: 97848303-97848370 [+]

Database links

• ENTREZGENE: 407011;MIR23B
• HGNC: 31606;MIR23B

Mature sequence hsa-miR-23b-5p

• Accession: MIMAT0004587
• Previous IDs: hsa-miR-23b*
• Sequence: 20 - uggguuccuggcaugcugauuu - 41
• Deep sequencing: 2492 reads, 15 experiments
• Evidence: experimental; cloned [3]
• Validated targets:
  • TARBASE:hsa-miR-23b-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-23b-5p
  • MICRORNA.ORG:hsa-miR-23b-5p
  • MIRDB:hsa-miR-23b-5p
  • RNA22-HSA:hsa-miR-23b-5p
  • TARGETMINER:hsa-miR-23b-5p
  • PICTAR-VERT:hsa-miR-23b

Mature sequence hsa-miR-23b-3p

• Accession: MIMAT0000418
• Previous IDs: hsa-miR-23b
• Sequence: 58 - aucacauugccagggauuacc - 78
• Deep sequencing: 109709 reads, 46 experiments
• Evidence: experimental; cloned [2-3]
• Validated targets:
  • TARBASE:hsa-miR-23b-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-23b-3p
  • MICRORNA.ORG:hsa-miR-23b-3p
  • MIRDB:hsa-miR-23b-3p
  • RNA22-HSA:hsa-miR-23b-3p
  • TARGETMINER:hsa-miR-23b-3p
  • TARGETSCAN-VERT:hsa-miR-23b
  • PICTAR-VERT:hsa-miR-23b

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).