Stem-loop sequence hsa-mir-23b

AccessionMI0000439
Symbol HGNC:MIR23B
DescriptionHomo sapiens miR-23b stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
   c     u c  -   c   u   --          -  c      gugacu 
5'  ucagg g uc ugg ugc ugg  guuccuggca ug ugauuu      u
    ||||| | || ||| ||| |||  |||||||||| || ||||||       
3'  gguuc c ag acc acg acc  uagggaccgu ac acuaaa      a
   c     - -  c   a   c   au          u  -      auuaga 
Get sequence
Deep sequencing
104407 reads, 1.67e+04 reads per million, 80 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr9: 95085208-95085304 [+]
antisense
OTTHUMT00000053082 ; NOL8-010; intron 2
OTTHUMT00000053080 ; NOL8-008; intron 2
OTTHUMT00000402688 ; NOL8-020; intron 2
OTTHUMT00000053078 ; NOL8-006; intron 3
OTTHUMT00000402684 ; NOL8-015; intron 3
OTTHUMT00000053075 ; NOL8-003; intron 3
OTTHUMT00000402685 ; NOL8-017; intron 3
OTTHUMT00000053076 ; NOL8-004; intron 3
OTTHUMT00000402687 ; NOL8-013; intron 3
OTTHUMT00000053079 ; NOL8-007; intron 3
OTTHUMT00000402693 ; NOL8-028; intron 3
OTTHUMT00000402689 ; NOL8-018; intron 3
OTTHUMT00000402690 ; NOL8-019; intron 3
OTTHUMT00000402695 ; NOL8-024; intron 3
OTTHUMT00000402697 ; NOL8-022; intron 3
OTTHUMT00000402682 ; NOL8-012; intron 4
OTTHUMT00000402683 ; NOL8-016; intron 4
OTTHUMT00000053077 ; NOL8-005; intron 4
OTTHUMT00000402691 ; NOL8-027; intron 4
OTTHUMT00000402692 ; NOL8-025; intron 4
OTTHUMT00000402694 ; NOL8-026; intron 4
OTTHUMT00000402696 ; NOL8-021; intron 4
OTTHUMT00000053074 ; NOL8-002; exon 4
ENST00000535387 ; NOL8-010; intron 2
ENST00000542053 ; NOL8-008; intron 2
ENST00000411621 ; NOL8-020; intron 2
ENST00000442668 ; NOL8-006; intron 3
ENST00000545558 ; NOL8-015; intron 3
ENST00000360868 ; NOL8-003; intron 3
ENST00000544867 ; NOL8-017; intron 3
ENST00000432670 ; NOL8-004; intron 3
ENST00000433029 ; NOL8-013; intron 3
ENST00000421075 ; NOL8-007; intron 3
ENST00000445919 ; NOL8-028; intron 3
ENST00000535807 ; NOL8-018; intron 3
ENST00000536624 ; NOL8-019; intron 3
ENST00000543985 ; NOL8-024; intron 3
ENST00000538215 ; NOL8-022; intron 3
ENST00000545444 ; NOL8-012; intron 4
ENST00000536593 ; NOL8-016; intron 4
ENST00000434228 ; NOL8-005; intron 4
ENST00000542613 ; NOL8-027; intron 4
ENST00000542573 ; NOL8-025; intron 4
ENST00000543260 ; NOL8-026; intron 4
ENST00000544321 ; NOL8-021; intron 4
ENST00000482475 ; NOL8-002; exon 4
ENST00000358855 ; NOL8-201; intron 4
Clustered miRNAs
< 10kb from hsa-mir-23b
hsa-mir-23bchr9: 95085208-95085304 [+]
hsa-mir-27bchr9: 95085445-95085541 [+]
hsa-mir-3074chr9: 95086014-95086094 [-]
hsa-mir-24-1chr9: 95086021-95086088 [+]
Database links

Mature sequence hsa-miR-23b-5p

Accession MIMAT0004587
Previous IDshsa-miR-23b*
Sequence

20 - 

uggguuccuggcaugcugauuu

 - 41

Get sequence
Deep sequencing2888 reads, 44 experiments
Evidence experimental; cloned [3]
Validated targets
Predicted targets

Mature sequence hsa-miR-23b-3p

Accession MIMAT0000418
Previous IDshsa-miR-23b
Sequence

58 - 

aucacauugccagggauuacc

 - 78

Get sequence
Deep sequencing2067 reads, 62 experiments
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).