Stem-loop sequence hsa-mir-15b

AccessionMI0000438 (change log)
Symbol HGNC:MIR15B
DescriptionHomo sapiens miR-15b stem-loop
Gene family MIPF0000006; mir-15
Literature search

405 open access papers mention hsa-mir-15b
(1473 sentences)

Stem-loop
   u    --g       gua   u       c  c      ua   g  ac 
5'  ugag   ccuuaaa   cug agcagca au augguu  cau cu  a
    ||||   |||||||   ||| ||||||| || ||||||  ||| ||  g
3'  acuu   ggaauuu   gau ucgucgu ua uacuaa  gua ga  u
   u    aaa       aaa   c       u  u      gc   -  ac 
Get sequence
Deep sequencing
1141703 reads, 6.2e+03 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-15b in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 160404588-160404685 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-15b
hsa-mir-15bchr3: 160404588-160404685 [+]
hsa-mir-16-2chr3: 160404745-160404825 [+]
Database links

Mature sequence hsa-miR-15b-5p

Accession MIMAT0000417
Previous IDshsa-miR-15b
Sequence

20 - 

uagcagcacaucaugguuuaca

 - 41

Get sequence
Deep sequencing1123901 reads, 159 experiments
Evidence experimental; cloned [2-5]
Database links
Predicted targets

Mature sequence hsa-miR-15b-3p

Accession MIMAT0004586
Previous IDshsa-miR-15b*
Sequence

58 - 

cgaaucauuauuugcugcucua

 - 79

Get sequence
Deep sequencing17528 reads, 129 experiments
Evidence experimental; cloned [4-5]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).