Stem-loop sequence hsa-let-7i

Accession MI0000434
Symbol HGNC:MIRLET7I
Description Homo sapiens let-7i stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c    u                 u   --------  u     ugu 
 uggc gagguaguaguuugugc guu        gg cgggu   g
 |||| ||||||||||||||||| |||        || |||||   a
 aucg uuccgucaucgaacgcg caa        uc gcccg   c
-    -                 u   uagaggug  -     uua 
Get sequence
Deep sequencing
684476 reads, 46 experiments
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr12: 62997466-62997549 [+]
sense
OTTHUMT00000406759 ; RP11-631N16.2-001; intron 1
OTTHUMT00000406759 ; RP11-631N16.2-001; intron 1
OTTHUMT00000406759 ; RP11-631N16.2-001; intron 1
ENST00000550290 ; RP11-631N16.2-001; intron 1
ENST00000362309 ; MIRLET7I-201; exon 1
ENST00000550290 ; RP11-631N16.2-001; intron 1
ENST00000362309 ; MIRLET7I-201; exon 1
ENST00000550290 ; RP11-631N16.2-001; intron 1
ENST00000362309 ; MIRLET7I-201; exon 1
antisense
OTTHUMT00000406740 ; C12orf61-001; 5'UTR (exon 1)
OTTHUMT00000406740 ; C12orf61-001; 5'UTR (exon 1)
Database links

Mature sequence hsa-let-7i-5p

Accession MIMAT0000415
Previous IDs hsa-let-7i
Sequence

6 - 

ugagguaguaguuugugcuguu

 - 27

Get sequence
Deep sequencing 684045 reads, 35 experiments
Evidence experimental; cloned [2-3], Solexa [5]
Validated targets
Predicted targets

Mature sequence hsa-let-7i-3p

Accession MIMAT0004585
Previous IDs hsa-let-7i*
Sequence

62 - 

cugcgcaagcuacugccuugcu

 - 83

Get sequence
Deep sequencing 431 reads, 26 experiments
Evidence experimental; cloned [2-4]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4
PMID:17989717 "Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis" Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A Leukemia. 22:330-338(2008).
5