Stem-loop sequence hsa-let-7i

AccessionMI0000434 (change log)
Symbol HGNC:MIRLET7I
DescriptionHomo sapiens let-7i stem-loop
Gene family MIPF0000002; let-7
Literature search

1093 open access papers mention hsa-let-7i
(5896 sentences)

Stem-loop
   c    u                 u   --------  u     ugu 
5'  uggc gagguaguaguuugugc guu        gg cgggu   g
    |||| ||||||||||||||||| |||        || |||||   a
3'  aucg uuccgucaucgaacgcg caa        uc gcccg   c
   -    -                 u   uagaggug  -     uua 
Get sequence
Deep sequencing
6318870 reads, 1.7e+04 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 62603686-62603769 [+]
antisense
OTTHUMT00000408016 ; FAM19A2-003; intron 1
OTTHUMT00000408104 ; FAM19A2-014; intron 1
OTTHUMT00000407968 ; FAM19A2-002; intron 2
OTTHUMT00000408100 ; FAM19A2-012; intron 2
OTTHUMT00000408103 ; FAM19A2-013; intron 2
ENST00000551619 ; FAM19A2-003; intron 1
ENST00000547919 ; FAM19A2-014; intron 1
ENST00000549379 ; FAM19A2-002; intron 2
ENST00000552075 ; FAM19A2-012; intron 2
ENST00000549456 ; FAM19A2-013; intron 2
Database links

Mature sequence hsa-let-7i-5p

Accession MIMAT0000415
Previous IDshsa-let-7i
Sequence

6 - 

ugagguaguaguuugugcuguu

 - 27

Get sequence
Deep sequencing6308844 reads, 159 experiments
Evidence experimental; cloned [2-3], Illumina [5]
Database links
Predicted targets

Mature sequence hsa-let-7i-3p

Accession MIMAT0004585
Previous IDshsa-let-7i*
Sequence

62 - 

cugcgcaagcuacugccuugcu

 - 83

Get sequence
Deep sequencing10008 reads, 145 experiments
Evidence experimental; cloned [2-4]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4
PMID:17989717 "Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis" Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A Leukemia. 22:330-338(2008).
5