Stem-loop sequence hsa-let-7g

AccessionMI0000433
Symbol HGNC:MIRLET7G
DescriptionHomo sapiens let-7g stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF0000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a   u        a            ugagg    -a  a    a 
5'  ggc gagguagu guuuguacaguu     gucu  ug uacc c
    ||| |||||||| ||||||||||||     ||||  || ||||  
3'  ccg uuccguca cggacaugucaa     uaga  ac augg c
   a   -        c            -----    gg  -    c 
Get sequence
Deep sequencing
199661 reads, 9e+03 reads per million, 74 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

let-7g-3p cloned in [2] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr3: 52268278-52268361 [-]
sense
OTTHUMT00000350199 ; TWF2-001; intron 2
OTTHUMT00000367018 ; TWF2-005; intron 2
ENST00000597542 ; TLR9-201; intron 2
ENST00000305533 ; TWF2-001; intron 2
ENST00000499914 ; TWF2-005; intron 2
Database links

Mature sequence hsa-let-7g-5p

Accession MIMAT0000414
Previous IDshsa-let-7g
Sequence

5 - 

ugagguaguaguuuguacaguu

 - 26

Get sequence
Deep sequencing4715 reads, 61 experiments
Evidence experimental; cloned [2-3], Illumina [4]
Validated targets
Predicted targets

Mature sequence hsa-let-7g-3p

Accession MIMAT0004584
Previous IDshsa-let-7g*
Sequence

62 - 

cuguacaggccacugccuugc

 - 82

Get sequence
Deep sequencing56 reads, 22 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4