Stem-loop sequence hsa-let-7g

AccessionMI0000433 (change log)
Symbol HGNC:MIRLET7G
DescriptionHomo sapiens let-7g stem-loop
Gene family MIPF0000002; let-7
Literature search

1077 open access papers mention hsa-let-7g
(5919 sentences)

Stem-loop
   a   u        a            ugagg    -a  a    a 
5'  ggc gagguagu guuuguacaguu     gucu  ug uacc c
    ||| |||||||| ||||||||||||     ||||  || ||||  
3'  ccg uuccguca cggacaugucaa     uaga  ac augg c
   a   -        c            -----    gg  -    c 
Get sequence
Deep sequencing
50510152 reads, 1.03e+05 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

let-7g-3p cloned in [2] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 52268278-52268361 [-]
sense
OTTHUMT00000350199 ; TWF2-001; intron 2
OTTHUMT00000367018 ; TWF2-005; intron 2
ENST00000597542 ; TLR9-201; intron 2
ENST00000305533 ; TWF2-001; intron 2
ENST00000499914 ; TWF2-005; intron 2
Database links

Mature sequence hsa-let-7g-5p

Accession MIMAT0000414
Previous IDshsa-let-7g
Sequence

5 - 

ugagguaguaguuuguacaguu

 - 26

Get sequence
Deep sequencing50508337 reads, 159 experiments
Evidence experimental; cloned [2-3], Illumina [4]
Database links
Predicted targets

Mature sequence hsa-let-7g-3p

Accession MIMAT0004584
Previous IDshsa-let-7g*
Sequence

62 - 

cuguacaggccacugccuugc

 - 82

Get sequence
Deep sequencing1795 reads, 125 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4