Stem-loop sequence dme-mir-iab-4

AccessionMI0000432 (change log)
DescriptionDrosophila melanogaster miR-iab-4 stem-loop
Gene family MIPF0000151; mir-iab-4
Stem-loop
       -aa            u    c   ag  u 
5' ucgu   acguauacugaa guau cug  ug a
   ||||   |||||||||||| |||| |||  || u
3' agca   ugcauaugacuu caua ggc  au c
       caa            c    u   cu  c 
Get sequence
Deep sequencing
9877 reads, 438 reads per million, 45 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

iab-4 is a transcript of the Bithorax complex which has been previously shown to contribute to proper formation of abdominal segments [2]. Reference [1] identified a miRNA gene within the transcript and mapped the ends of the mature miR sequence by cloning. Excised miR sequences were identified from both arms of the precursor and are named miR-iab-4-5p (5') and miR-iab-4-3p (3') as too few sequences were cloned to decide on which was predominantly expressed.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 16856275-16856342 [+]
sense
FBtr0083362 ; iab-4-RA; exon 3
antisense
FBtr0306338 ; msa-RA; intron 4
FBtr0306339 ; msa-RB; intron 4
FBtr0309897 ; msa-RD; intron 5
FBtr0306340 ; msa-RC; intron 5
Clustered miRNAs
< 10kb from dme-mir-iab-4
dme-mir-iab-8chr3R: 16856275-16856342 [-]
dme-mir-iab-4chr3R: 16856275-16856342 [+]
Database links

Mature sequence dme-miR-iab-4-5p

Accession MIMAT0000412
Sequence

7 - 

acguauacugaauguauccuga

 - 28

Get sequence
Deep sequencing8778 reads, 44 experiments
Evidence experimental; cloned [1], 454 [3-4], Illumina [4]
Database links
Predicted targets

Mature sequence dme-miR-iab-4-3p

Accession MIMAT0000413
Sequence

41 - 

cgguauaccuucaguauacguaac

 - 64

Get sequence
Deep sequencing1099 reads, 28 experiments
Evidence experimental; cloned [1], 454 [3-4], Illumina [4]
Database links
Predicted targets

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).