Stem-loop sequence dme-mir-2c

AccessionMI0000431 (change log)
DescriptionDrosophila melanogaster miR-2c stem-loop
Gene family MIPF0000049; mir-2
Literature search

28 open access papers mention dme-mir-2c
(103 sentences)

Stem-loop
       au    c  u       -      aag     aagaaagauauuucu 
5' ucgu  cuua uu caauguc aucaaa   ggcug               g
   ||||  |||| || ||||||| ||||||   |||||                
3' agcg  gagu aa guuacgg uaguuu   ccgac               c
       ac    -  c       g      cga     acuaugcuaaguuua 
Get sequence
Deep sequencing
924946 reads, 1.67e+04 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-2c was predicted by similarity to miR-2a (MI0000117). Expression in Drosophila was independently confirmed by Northern blot analysis [1] and by cloning [2]. The latter study confirmed the ends of the excised miR. Stark et al. [3] have identified targets for miR-2 in Drosophila using computational prediction followed by experimental validation. miR-2 regulates the proapoptotic genes reaper, grim and sickle, suggesting that it may be involved in the control of apoptosis.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 15417744-15417845 [-]
intergenic
Clustered miRNAs
< 10kb from dme-mir-2c
dme-mir-2cchr3R: 15417744-15417845 [-]
dme-mir-13achr3R: 15417542-15417616 [-]
dme-mir-13b-1chr3R: 15417408-15417475 [-]
Database links

Mature sequence dme-miR-2c-5p

Accession MIMAT0020845
Sequence

20 - 

ucaucaaaaagggcugaagaaagau

 - 44

Get sequence
Deep sequencing6936 reads, 45 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-2c-3p

Accession MIMAT0000411
Previous IDsdme-miR-2c
Sequence

63 - 

uaucacagccagcuuugaugggc

 - 85

Get sequence
Deep sequencing918005 reads, 49 experiments
Evidence experimental; Northern [1], cloned [2], 454 [4-5], Illumina [5]
Database links
Predicted targets

References

1
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
PMID:14691535 "Identification of Drosophila MicroRNA targets" Stark A, Brennecke J, Russell RB, Cohen SM PLoS Biol. 1:E60(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).