Stem-loop sequence dme-mir-318

AccessionMI0000430 (change log)
DescriptionDrosophila melanogaster miR-318 stem-loop
Gene family MIPF0000259; mir-318
Literature search

2 open access papers mention dme-mir-318
(2 sentences)

Stem-loop
   u          c   c        uu   caca 
5'  uuaugggaua aca aguucagu  ugu    c
    |||||||||| ||| ||||||||  |||     
3'  aguacucuau ugu ucggguca  acg    u
   g          u   u        cu   aacu 
Get sequence
Deep sequencing
829914 reads, 5.41e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 10408302-10408369 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-318
dme-mir-994chr3R: 10408137-10408227 [+]
dme-mir-318chr3R: 10408302-10408369 [+]
Database links

Mature sequence dme-miR-318-5p

Accession MIMAT0020844
Sequence

7 - 

ggauacacacaguucaguuuug

 - 28

Get sequence
Deep sequencing1291 reads, 24 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-318-3p

Accession MIMAT0000410
Previous IDsdme-miR-318
Sequence

43 - 

ucacugggcuuuguuuaucuca

 - 64

Get sequence
Deep sequencing828611 reads, 49 experiments
Evidence experimental; cloned [1], 454 [2-3], Illumina [3]
Database links
Predicted targets

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).