Stem-loop sequence dme-mir-314

AccessionMI0000426 (change log)
DescriptionDrosophila melanogaster miR-314 stem-loop
Gene family MIPF0000246; mir-314
Literature search

3 open access papers mention dme-mir-314
(3 sentences)

Stem-loop
   u  u       g     u    cu    uaguu    ---a   c   ca 
5'  cg aacuugu uggcu cgaa  uacc     gagg    aaa ucc  u
    || ||||||| ||||| ||||  ||||     ||||    ||| |||   
3'  gc uugaaua accga gcuu  augg     cucc    uuu agg  g
   g  -       -     -    --    ----u    auug   u   cu 
Get sequence
Deep sequencing
13568 reads, 287 reads per million, 47 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3L: 11773012-11773101 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-314
dme-mir-314chr3L: 11773012-11773101 [+]
dme-mir-956chr3L: 11773731-11773878 [-]
Database links

Mature sequence dme-miR-314-5p

Accession MIMAT0020840
Sequence

3 - 

guaacuuguguggcuucgaacuuacc

 - 28

Get sequence
Deep sequencing2151 reads, 35 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-314-3p

Accession MIMAT0000406
Previous IDsdme-miR-314
Sequence

70 - 

uauucgagccaauaaguucgg

 - 90

Get sequence
Deep sequencing11309 reads, 47 experiments
Evidence experimental; cloned [1], 454 [2-3], Illumina [3]
Database links
Predicted targets

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).