Stem-loop sequence dme-mir-310

AccessionMI0000422 (change log)
DescriptionDrosophila melanogaster miR-310 stem-loop
Gene family MIPF0000566; mir-310
Literature search

18 open access papers mention dme-mir-310
(109 sentences)

Stem-loop
        -aa       c   g    uc     u       u   u 
5' aacau   acauuug agg cggg  gugug cagugua uua a
   |||||   ||||||| ||| ||||  ||||| ||||||| ||| u
3' uugua   uguaaau ucc gccc  cacac guuauau gau c
        acc       u   g    uu     -       c   u 
Get sequence
Deep sequencing
26954 reads, 1.72e+03 reads per million, 48 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 20583752-20583840 [-]
intergenic
Clustered miRNAs
< 10kb from dme-mir-310
dme-mir-992chr2R: 20585314-20585405 [-]
dme-mir-991chr2R: 20585200-20585295 [-]
dme-mir-2498chr2R: 20584709-20584820 [-]
dme-mir-313chr2R: 20584190-20584260 [-]
dme-mir-312chr2R: 20584056-20584121 [-]
dme-mir-311chr2R: 20583877-20583960 [-]
dme-mir-310chr2R: 20583752-20583840 [-]
Database links

Mature sequence dme-miR-310-5p

Accession MIMAT0020836
Sequence

16 - 

agggcgggucgugugucagugua

 - 38

Get sequence
Deep sequencing308 reads, 32 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-310-3p

Accession MIMAT0000402
Previous IDsdme-miR-310
Sequence

54 - 

uauugcacacuucccggccuuu

 - 75

Get sequence
Deep sequencing26644 reads, 48 experiments
Evidence experimental; Northern [1], 454 [2-3], Illumina [3]
Database links
Predicted targets

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).