|
miRBase |
|
Stem-loop sequence dme-mir-309 |
|||||
| Accession | MI0000421 | ||||
| Description | Drosophila melanogaster miR-309 stem-loop | ||||
| Gene family | MIPF0000140; mir-3 | ||||
| Stem-loop |
c c uu u c aau auuaua gacaaac uug cggu uug c u |||||| ||||||| ||| |||| ||| | u uaauau cuguuug aau guca gac g c c a gg c c aac |
||||
| Deep sequencing |
| ||||
| Comments |
miR-309 was identified and ends mapped by cloning. The sequence is localised to chromosome 2R. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
Mature sequence dme-miR-309-5p |
|
| Accession | MIMAT0020835 |
| Sequence |
7 - cgacaaaccuuguucgguuuug - 28 |
| Deep sequencing | 2205 reads, 21 experiments |
| Evidence | not experimental |
| Predicted targets |
|
Mature sequence dme-miR-309-3p |
|
| Accession | MIMAT0000401 |
| Previous IDs | dme-miR-309 |
| Sequence |
44 - gcacuggguaaaguuuguccua - 65 |
| Deep sequencing | 44365 reads, 35 experiments |
| Evidence | experimental; cloned [1], 454 [2-3], Solexa [3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:12919683
"The small RNA profile during Drosophila melanogaster development"
Dev Cell. 5:337-350(2003).
|
| 2 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
| 3 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|