Stem-loop sequence dme-mir-309

AccessionMI0000421 (change log)
DescriptionDrosophila melanogaster miR-309 stem-loop
Gene family MIPF0000140; mir-3
Literature search

18 open access papers mention dme-mir-309
(72 sentences)

Stem-loop
         c       c   uu    u   c aau 
5' auuaua gacaaac uug  cggu uug c   u
   |||||| ||||||| |||  |||| ||| |   u
3' uaauau cuguuug aau  guca gac g   c
         c       a   gg    c   c aac 
Get sequence
Deep sequencing
13982 reads, 1.37e+03 reads per million, 31 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 19661706-19661774 [-]
intergenic
Clustered miRNAs
< 10kb from dme-mir-309
dme-mir-309chr2R: 19661706-19661774 [-]
dme-mir-3chr2R: 19661595-19661663 [-]
dme-mir-286chr2R: 19661422-19661521 [-]
dme-mir-4chr2R: 19661289-19661369 [-]
dme-mir-5chr2R: 19661158-19661226 [-]
dme-mir-6-1chr2R: 19661003-19661084 [-]
dme-mir-6-2chr2R: 19660869-19660942 [-]
dme-mir-6-3chr2R: 19660716-19660795 [-]
Database links

Mature sequence dme-miR-309-5p

Accession MIMAT0020835
Sequence

7 - 

cgacaaaccuuguucgguuuug

 - 28

Get sequence
Deep sequencing912 reads, 21 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-309-3p

Accession MIMAT0000401
Previous IDsdme-miR-309
Sequence

44 - 

gcacuggguaaaguuuguccua

 - 65

Get sequence
Deep sequencing13068 reads, 26 experiments
Evidence experimental; cloned [1], 454 [2-3], Illumina [3]
Database links
Predicted targets

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).