Stem-loop sequence dme-mir-31a

AccessionMI0000420 (change log)
DescriptionDrosophila melanogaster miR-31a stem-loop
Gene family MIPF0000064; mir-31
Literature search

8 open access papers mention dme-mir-31a
(35 sentences)

Stem-loop
           ua       a     u         ugacguugaaaa 
5' uccguugg  aauuggc agaug cggcauagc            g
   ||||||||  ||||||| ||||| |||||||||            c
3' agguaacu  uugacug ucuac gucguaucg            g
           ug       a     -         cgagaaguuuua 
Get sequence
Deep sequencing
1477616 reads, 8.22e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 17783795-17783886 [-]
intergenic
Database links

Mature sequence dme-miR-31a-5p

Accession MIMAT0000400
Previous IDsdme-miR-31a
Sequence

14 - 

uggcaagaugucggcauagcuga

 - 36

Get sequence
Deep sequencing1476345 reads, 49 experiments
Evidence experimental; cloned [1], 454 [2-3], Illumina [3]
Database links
Predicted targets

Mature sequence dme-miR-31a-3p

Accession MIMAT0020834
Sequence

60 - 

cgcuaugcugcaucuagucagu

 - 81

Get sequence
Deep sequencing1263 reads, 44 experiments
Evidence not experimental
Database links

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).