Stem-loop sequence dme-mir-308

AccessionMI0000419 (change log)
DescriptionDrosophila melanogaster miR-308 stem-loop
Gene family MIPF0000171; mir-308
Literature search

3 open access papers mention dme-mir-308
(9 sentences)

Stem-loop
              u       u    uu c u 
5' cucgcaguaua uuuugug uuug  u g u
   ||||||||||| ||||||| ||||  | | u
3' gagugucauau aggacac aaac  a c u
              u       u    cu a g 
Get sequence
Deep sequencing
542566 reads, 1.15e+04 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 14215802-14215864 [-]
sense
FBtr0087575 ; RpS23-RA; intron 2
Database links

Mature sequence dme-miR-308-5p

Accession MIMAT0020833
Sequence

3 - 

cgcaguauauuuuuguguuuug

 - 24

Get sequence
Deep sequencing13849 reads, 49 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-308-3p

Accession MIMAT0000399
Previous IDsdme-miR-308
Sequence

42 - 

aaucacaggauuauacugugag

 - 63

Get sequence
Deep sequencing528690 reads, 48 experiments
Evidence experimental; cloned [1], 454 [2-3], Illumina [3]
Database links
Predicted targets

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).