![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence dme-mir-307a |
||||||
Accession | MI0000418 (change log) | |||||
Previous IDs | dme-mir-307 | |||||
Description | Drosophila melanogaster miR-307a stem-loop | |||||
Gene family | MIPF0000293; mir-67 | |||||
Literature search |
![]()
6 open access papers mention dme-mir-307a | |||||
Stem-loop |
u - a ccu g -u uc 5' gucuugcu uug cucacucaa gg ugugaug uauu g |||||||| ||| ||||||||| || ||||||| |||| a 3' caggacga agc gagugaguu cc acacuac augg u a u - ccu a cu ua |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence dme-miR-307a-5p |
|
Accession | MIMAT0020832 |
Sequence |
13 - acucacucaaccugggugugau - 34 |
Deep sequencing | 4784 reads, 44 experiments |
Evidence | not experimental |
Database links |
|
Mature sequence dme-miR-307a-3p |
|
Accession | MIMAT0000398 |
Previous IDs | dme-miR-307 |
Sequence |
56 - ucacaaccuccuugagugagcga - 78 |
Deep sequencing | 21965 reads, 49 experiments |
Evidence | experimental; cloned [1], 454 [2-3], Illumina [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12919683
"The small RNA profile during Drosophila melanogaster development"
Dev Cell. 5:337-350(2003).
|
2 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
3 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|