Stem-loop sequence dme-mir-307a

AccessionMI0000418 (change log)
Previous IDsdme-mir-307
DescriptionDrosophila melanogaster miR-307a stem-loop
Gene family MIPF0000293; mir-67
Literature search

6 open access papers mention dme-mir-307a
(51 sentences)

Stem-loop
   u        -   a         ccu  g       -u    uc 
5'  gucuugcu uug cucacucaa   gg ugugaug  uauu  g
    |||||||| ||| |||||||||   || |||||||  ||||  a
3'  caggacga agc gagugaguu   cc acacuac  augg  u
   a        u   -         ccu  a       cu    ua 
Get sequence
Deep sequencing
26774 reads, 786 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 9621251-9621338 [-]
sense
FBtr0088501 ; Mmp2-RB; intron 3
antisense
FBtr0304171 ; mir-307b-RM; exon 1
Clustered miRNAs
< 10kb from dme-mir-307a
dme-mir-307achr2R: 9621251-9621338 [-]
dme-mir-307bchr2R: 9621234-9621353 [+]
Database links

Mature sequence dme-miR-307a-5p

Accession MIMAT0020832
Sequence

13 - 

acucacucaaccugggugugau

 - 34

Get sequence
Deep sequencing4784 reads, 44 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-307a-3p

Accession MIMAT0000398
Previous IDsdme-miR-307
Sequence

56 - 

ucacaaccuccuugagugagcga

 - 78

Get sequence
Deep sequencing21965 reads, 49 experiments
Evidence experimental; cloned [1], 454 [2-3], Illumina [3]
Database links
Predicted targets

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).