Stem-loop sequence dme-mir-125

Accession MI0000417
Description Drosophila melanogaster miR-125 stem-loop
Gene family MIPF0000017; mir-125
Stem-loop 
     gu    au      augg ug  uc  u    c cu         cu  ua 
gacau  gcaa  guuugu    c  au  cc gaga c  aacuuguga  uu  a
|||||  ||||  ||||||    |  ||  || |||| |  |||||||||  ||  u
uugua  cguu  caaacg    g  ua  gg cucu g  uugaacacu  ga  a
     gu    --      --ca gu  -u  c    a uu         uu  cc
Get sequence
Deep sequencing
108706 reads, 49 experiments
Comments

miR-125 was identified and ends mapped by cloning. The sequence is localised to chromosome 2L.

Genome context
Coordinates (BDGP5.0) Overlapping transcripts
2L: 18472315-18472424 [+]
sense
FBtr0306973 ; CR43344-RA; exon 2
FBtr0306973 ; CR43344-RA; exon 2
Clustered miRNAs
< 10kb from dme-mir-125
dme-mir-100 2L: 18471434-18471533 [+]
dme-let-7 2L: 18472034-18472111 [+]
dme-mir-125 2L: 18472315-18472424 [+]

Mature sequence dme-miR-125-5p

Accession MIMAT0000397
Previous IDs dme-miR-125
Sequence

29 -  

ucccugagacccuaacuuguga

 - 50

Get sequence
Deep sequencing 107459 reads, 49 experiments
Evidence experimental; Northern [1-2], 454 [3-4], Solexa [4]
Predicted targets

Mature sequence dme-miR-125-3p

Accession MIMAT0020831
Sequence

68 -  

acaaguuuugaucuccgguau

 - 88

Get sequence
Deep sequencing 1243 reads, 33 experiments
Evidence not experimental
Predicted targets

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
PMID:12812784 "Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity" Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V Dev Biol. 259:9-18(2003).
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).