Stem-loop sequence dme-mir-125

AccessionMI0000417
DescriptionDrosophila melanogaster miR-125 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
        gu    au      augg ug  uc  u    c cu         cu  ua 
5' gacau  gcaa  guuugu    c  au  cc gaga c  aacuuguga  uu  a
   |||||  ||||  ||||||    |  ||  || |||| |  |||||||||  ||  u
3' uugua  cguu  caaacg    g  ua  gg cucu g  uugaacacu  ga  a
        gu    --      --ca gu  -u  c    a uu         uu  cc 
Get sequence
Deep sequencing
108501 reads, 6.41e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BDGP5.0) Overlapping transcripts
2L: 18472315-18472424 [+]
sense
FBtr0306973 ; CR43344-RA; exon 2
Clustered miRNAs
< 10kb from dme-mir-125
dme-mir-1002L: 18471434-18471533 [+]
dme-let-72L: 18472034-18472111 [+]
dme-mir-1252L: 18472315-18472424 [+]
Database links

Mature sequence dme-miR-125-5p

Accession MIMAT0000397
Previous IDsdme-miR-125
Sequence

29 - 

ucccugagacccuaacuuguga

 - 50

Get sequence
Deep sequencing93351 reads, 49 experiments
Evidence experimental; Northern [1-2], 454 [3-4], Illumina [4]
Predicted targets

Mature sequence dme-miR-125-3p

Accession MIMAT0020831
Sequence

68 - 

acaaguuuugaucuccgguau

 - 88

Get sequence
Deep sequencing1116 reads, 31 experiments
Evidence not experimental
Predicted targets

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).