Stem-loop sequence dme-let-7

AccessionMI0000416 (change log)
Previous IDsdme-let-7L
DescriptionDrosophila melanogaster let-7 stem-loop
Gene family MIPF0000002; let-7
Literature search

78 open access papers mention dme-let-7
(770 sentences)

Stem-loop
     u      uu   g     g           guaauu 
5' uc ggcaaa  gag uagua guuguauagua      a
   || ||||||  ||| ||||| |||||||||||       
3' ag ucguuu  uuc aucgu uaacauaucau      c
     u      cu   g     g           acuaca 
Get sequence
Deep sequencing
895953 reads, 8.21e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 18472034-18472111 [+]
sense
FBtr0306973 ; CR43344-RA; exon 2
Clustered miRNAs
< 10kb from dme-let-7
dme-mir-100chr2L: 18471434-18471533 [+]
dme-let-7chr2L: 18472034-18472111 [+]
dme-mir-125chr2L: 18472315-18472424 [+]
Database links

Mature sequence dme-let-7-5p

Accession MIMAT0000396
Previous IDsdme-let-7
Sequence

11 - 

ugagguaguagguuguauagu

 - 31

Get sequence
Deep sequencing894569 reads, 49 experiments
Evidence experimental; cloned [1], Northern [1-3], 454 [4-5], Illumina [5]
Database links
Predicted targets

Mature sequence dme-let-7-3p

Accession MIMAT0020830
Sequence

49 - 

cuauacaaugugcuagcuuucu

 - 70

Get sequence
Deep sequencing1384 reads, 42 experiments
Evidence not experimental
Database links

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
3
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).