Stem-loop sequence dme-mir-9b

Accession MI0000415
Description Drosophila melanogaster miR-9b stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u   --u        cuc         uuu    g     u  uua 
 gca   auuauuug   uuuggugau   agcu uaugg gu   u
 |||   ||||||||   |||||||||   |||| ||||| ||    
 cgu   ugguaaac   aaaccauua   ucga auacc ua   g
a   cuu        caa         -uu    g     u  uau 
Get sequence
Deep sequencing
235032 reads, 50 experiments
Comments

Lai et al. predicted this sequence based on conservation in D. pseudoobscura, but did not verify expression [2]. Aravin et al. describe identification and mapping of the 5' end of the excised sequence by cloning [1]. They report a length distribution of 21-23 nt, with 23 nt most commonly expressed. The sequence maps to chromosome 2L.

Genome context
Coordinates (BDGP5.0) Overlapping transcripts
2L: 16698744-16698834 [+]
sense
FBtr0100459 ; grp-RD; intron 4
FBtr0100459 ; grp-RD; intron 4
FBtr0100459 ; grp-RD; intron 4
FBtr0080886 ; grp-RA; intron 6
FBtr0080884 ; grp-RB; intron 6
FBtr0080886 ; grp-RA; intron 6
FBtr0080884 ; grp-RB; intron 6
FBtr0080886 ; grp-RA; intron 6
FBtr0080884 ; grp-RB; intron 6
FBtr0080885 ; grp-RC; intron 7
FBtr0080885 ; grp-RC; intron 7
FBtr0080885 ; grp-RC; intron 7
Clustered miRNAs
< 10kb from dme-mir-9b
dme-mir-9c 2L: 16697924-16698015 [+]
dme-mir-306 2L: 16698404-16698488 [+]
dme-mir-79 2L: 16698554-16698650 [+]
dme-mir-9b 2L: 16698744-16698834 [+]

Mature sequence dme-miR-9b-5p

Accession MIMAT0000395
Previous IDs dme-miR-9b
Sequence

15 - 

ucuuuggugauuuuagcuguaug

 - 37

Get sequence
Deep sequencing 220289 reads, 50 experiments
Evidence experimental; cloned [1], 454 [3-4], Solexa [4]
Predicted targets

Mature sequence dme-miR-9b-3p

Accession MIMAT0020829
Sequence

56 - 

uagagcuuuauuaccaaaaacc

 - 77

Get sequence
Deep sequencing 14708 reads, 49 experiments
Evidence not experimental
Predicted targets

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).