Stem-loop sequence dme-mir-9c

AccessionMI0000413 (change log)
DescriptionDrosophila melanogaster miR-9c stem-loop
Gene family MIPF0000014; mir-9
Literature search

24 open access papers mention dme-mir-9c
(92 sentences)

Stem-loop
       uu    uuu         ucu    g     u  uuc   c 
5' auuu  gcug   cuuugguau   agcu uagau gu   acg a
   ||||  ||||   |||||||||   |||| ||||| ||   ||| c
3' uaaa  cgac   gaaaccaua   ucga aucua ua   ugu a
       uu    cuc         uuu    a     c  -ua   u 
Get sequence
Deep sequencing
1366522 reads, 9e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Lai et al. predicted this sequence based on conservation in D. pseudoobscura, but did not verify expression [2]. Aravin et al. describe identification and mapping of the ends of the excised sequence by cloning [1].

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 16697924-16698015 [+]
sense
FBtr0100459 ; grp-RD; intron 3
FBtr0080884 ; grp-RB; intron 5
FBtr0080886 ; grp-RA; intron 5
FBtr0080885 ; grp-RC; intron 6
Clustered miRNAs
< 10kb from dme-mir-9c
dme-mir-9cchr2L: 16697924-16698015 [+]
dme-mir-306chr2L: 16698404-16698488 [+]
dme-mir-79chr2L: 16698554-16698650 [+]
dme-mir-9bchr2L: 16698744-16698834 [+]
Database links

Mature sequence dme-miR-9c-5p

Accession MIMAT0000392
Previous IDsdme-miR-9c
Sequence

13 - 

ucuuugguauucuagcuguaga

 - 34

Get sequence
Deep sequencing1302348 reads, 49 experiments
Evidence experimental; cloned [1], 454 [3-4], Illumina [4]
Database links
Predicted targets

Mature sequence dme-miR-9c-3p

Accession MIMAT0020828
Sequence

61 - 

uaaagcuuuuauaccaaagcuc

 - 82

Get sequence
Deep sequencing63955 reads, 40 experiments
Evidence not experimental
Database links

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).