Stem-loop sequence dme-mir-305

AccessionMI0000412 (change log)
DescriptionDrosophila melanogaster miR-305 stem-loop
Gene family MIPF0000158; mir-305
Literature search

12 open access papers mention dme-mir-305
(34 sentences)

Stem-loop
        cu u         u  g     cu  u  guc 
5' caugu  a uguacuuca ca gugcu  gg gu   u
   |||||  | ||||||||| || |||||  || ||    
3' guaua  u acaugaagu gu cacgg  cc ca   c
        ac c         u  a     --  -  aug 
Get sequence
Deep sequencing
752483 reads, 1.18e+04 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Lai et al. predicted this sequence based on conservation in D. pseudoobscura, but did not verify expression [2]. Aravin et al. describe identification and mapping of the 5' end of the excised sequence by cloning [1].

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 7425972-7426044 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-305
dme-mir-275chr2L: 7425795-7425892 [+]
dme-mir-305chr2L: 7425972-7426044 [+]
Database links

Mature sequence dme-miR-305-5p

Accession MIMAT0000391
Previous IDsdme-miR-305
Sequence

8 - 

auuguacuucaucaggugcucug

 - 30

Get sequence
Deep sequencing512260 reads, 49 experiments
Evidence experimental; cloned [1], 454 [3-4], Illumina [4]
Database links
Predicted targets

Mature sequence dme-miR-305-3p

Accession MIMAT0020827
Sequence

46 - 

cggcacauguugaaguacacuca

 - 68

Get sequence
Deep sequencing240219 reads, 49 experiments
Evidence not experimental
Database links

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).