Stem-loop sequence dme-mir-304

Accession MI0000411
Description Drosophila melanogaster miR-304 stem-loop
Gene family MIPF0000308; mir-304
Stem-loop 
    ca    a       aau       u     c -   u  g 
gcag  uuga uaaucuc   uuguaaa gugag g guu aa c
||||  |||| |||||||   ||||||| ||||| | ||| ||  
cguc  agcu guuagag   aacguuu cacuc c cag uu c
    ag    c       guu       -     a g   u  a
Get sequence
Deep sequencing
68434 reads, 49 experiments
Comments

miR-304 was identified and 5' end mapped by cloning. Reference [1] reports a length distribution of 21-23 nt, with 23 nt most commonly expressed. The sequence is localised to chromosome X.

Genome context
Coordinates (BDGP5.0) Overlapping transcripts
X: 15402992-15403079 [+]
sense
FBtr0074043 ; Gmap-RB; intron 4
FBtr0074043 ; Gmap-RB; intron 4
FBtr0074043 ; Gmap-RB; intron 4
FBtr0074042 ; Gmap-RA; intron 5
FBtr0074042 ; Gmap-RA; intron 5
FBtr0074042 ; Gmap-RA; intron 5
Clustered miRNAs
< 10kb from dme-mir-304
dme-mir-283 X: 15401989-15402088 [+]
dme-mir-304 X: 15402992-15403079 [+]
dme-mir-12 X: 15403506-15403579 [+]

Mature sequence dme-miR-304-5p

Accession MIMAT0000390
Previous IDs dme-miR-304
Sequence

12 -  

uaaucucaauuuguaaaugugag

 - 34

Get sequence
Deep sequencing 66042 reads, 49 experiments
Evidence experimental; cloned [1], 454 [2-3], Solexa [3]
Predicted targets

Mature sequence dme-miR-304-3p

Accession MIMAT0020826
Sequence

58 -  

cacuuugcaauuggagauugcu

 - 79

Get sequence
Deep sequencing 2245 reads, 36 experiments
Evidence not experimental
Predicted targets

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).