Stem-loop sequence dme-mir-304

AccessionMI0000411 (change log)
DescriptionDrosophila melanogaster miR-304 stem-loop
Gene family MIPF0000308; mir-304
Literature search

6 open access papers mention dme-mir-304
(80 sentences)

Stem-loop
       ca    a       aau       u     c -   u  g 
5' gcag  uuga uaaucuc   uuguaaa gugag g guu aa c
   ||||  |||| |||||||   ||||||| ||||| | ||| ||  
3' cguc  agcu guuagag   aacguuu cacuc c cag uu c
       ag    c       guu       -     a g   u  a 
Get sequence
Deep sequencing
41993 reads, 749 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 15508959-15509046 [+]
sense
FBtr0074043 ; Gmap-RB; intron 4
FBtr0074042 ; Gmap-RA; intron 5
Clustered miRNAs
< 10kb from dme-mir-304
dme-mir-283chrX: 15507956-15508055 [+]
dme-mir-304chrX: 15508959-15509046 [+]
dme-mir-12chrX: 15509473-15509546 [+]
Database links

Mature sequence dme-miR-304-5p

Accession MIMAT0000390
Previous IDsdme-miR-304
Sequence

12 - 

uaaucucaauuuguaaaugugag

 - 34

Get sequence
Deep sequencing40045 reads, 49 experiments
Evidence experimental; cloned [1], 454 [2-3], Illumina [3]
Database links
Predicted targets

Mature sequence dme-miR-304-3p

Accession MIMAT0020826
Sequence

58 - 

cacuuugcaauuggagauugcu

 - 79

Get sequence
Deep sequencing1618 reads, 44 experiments
Evidence not experimental
Database links

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).