Stem-loop sequence dme-mir-31b

AccessionMI0000410 (change log)
DescriptionDrosophila melanogaster miR-31b stem-loop
Gene family MIPF0000064; mir-31
Literature search

6 open access papers mention dme-mir-31b
(10 sentences)

Stem-loop
       -     aau     a     uc  a       agagcacagcggaucgaacauuuuauc 
5' caaa uaaug   uuggc agaug  gg auagcug                           g
   |||| |||||   ||||| |||||  || |||||||                           u
3' guuu auuac   aacug ucuac  cc uaucggc                           c
       c     guu     a     -u  g       gaaaaguuuuuauuaguguaaaaaagc 
Get sequence
Deep sequencing
1404420 reads, 7.91e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 8993305-8993431 [-]
sense
FBtr0332279 ; CR43836-RA; intron 2
FBtr0332280 ; CR43836-RB; intron 2
FBtr0332281 ; CR43836-RC; intron 2
antisense
FBtr0333602 ; rdgA-RI; intron 1
FBtr0333601 ; rdgA-RH; intron 1
FBtr0302660 ; rdgA-RA; intron 1
FBtr0302665 ; rdgA-RG; intron 1
FBtr0302661 ; rdgA-RB; intron 2
FBtr0302663 ; rdgA-RD; intron 3
FBtr0302664 ; rdgA-RE; intron 3
Database links

Mature sequence dme-miR-31b-5p

Accession MIMAT0000389
Previous IDsdme-miR-31b
Sequence

14 - 

uggcaagaugucggaauagcug

 - 35

Get sequence
Deep sequencing1403459 reads, 49 experiments
Evidence experimental; cloned [1], 454 [2-3], Illumina [3]
Database links
Predicted targets

Mature sequence dme-miR-31b-3p

Accession MIMAT0020825
Sequence

94 - 

ggcuaugccucaucuagucaau

 - 115

Get sequence
Deep sequencing893 reads, 21 experiments
Evidence not experimental
Database links

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).