|
miRBase |
|
Stem-loop sequence dme-mir-303 |
||||||||||||
| Accession | MI0000409 | |||||||||||
| Description | Drosophila melanogaster miR-303 stem-loop | |||||||||||
| Gene family | MIPF0001013; mir-303 | |||||||||||
| Stem-loop |
ua c c aau ucuugguu gguuu a aggaaacugguuu a |||||||| ||||| | ||||||||||||| agaacuaa cuaaa u uccuuugaucaaa a uc a c agc |
|||||||||||
| Deep sequencing |
| |||||||||||
| Comments |
miR-303 was identified and ends mapped by cloning. The sequence is localised to chromosome X. |
|||||||||||
| Genome context |
|
|||||||||||
| Clustered miRNAs |
|
|||||||||||
Mature sequence dme-miR-303-5p |
|
| Accession | MIMAT0000388 |
| Previous IDs | dme-miR-303 |
| Sequence |
7 - uuuagguuucacaggaaacuggu - 29 |
| Deep sequencing | 1387 reads, 43 experiments |
| Evidence | experimental; cloned [1], 454 [2-3], Solexa [3] |
| Predicted targets |
|
Mature sequence dme-miR-303-3p |
|
| Accession | MIMAT0020824 |
| Sequence |
43 - cuaguuuccucuaaaauccuaa - 64 |
| Deep sequencing | 269 reads, 25 experiments |
| Evidence | not experimental |
| Predicted targets |
|
References |
|
| 1 |
PMID:12919683
"The small RNA profile during Drosophila melanogaster development"
Dev Cell. 5:337-350(2003).
|
| 2 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
| 3 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|