Stem-loop sequence mmu-mir-130b

Accession MI0000408
Symbol MGI:Mir130b
Description Mus musculus miR-130b stem-loop
Gene family MIPF0000034; mir-130
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop 
      u    ca       cc         a  guggg  u 
ggcuug ugga  cucuuuc  uguugcacu cu     cc c
|||||| ||||  |||||||  ||||||||| ||     ||  
ccgggc gucu  gggaaag  guaacguga ga     gg u
      u    ac       ua         c  ----a  g
Get sequence
Deep sequencing
336836 reads, 95 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr16: 17124061-17124142 [-]
sense
ENSMUST00000093336 ; 2610318N02Rik-201; intron 1
Clustered miRNAs
< 10kb from mmu-mir-130b
mmu-mir-301b chr16: 17124400-17124496 [-]
mmu-mir-130b chr16: 17124061-17124142 [-]
Database links

Mature sequence mmu-miR-130b-5p

Accession MIMAT0004583
Previous IDs mmu-miR-130b*
Sequence

13 -  

acucuuucccuguugcacuacu

 - 34

Get sequence
Deep sequencing 6541 reads, 77 experiments
Evidence experimental; cloned [3], Solexa [4-5]
Predicted targets

Mature sequence mmu-miR-130b-3p

Accession MIMAT0000387
Previous IDs mmu-miR-130b
Sequence

51 -  

cagugcaaugaugaaagggcau

 - 72

Get sequence
Deep sequencing 67659 reads, 80 experiments
Evidence experimental; cloned [1-3], Northern [1], Solexa [4-5]
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).