Stem-loop sequence mmu-mir-130b

AccessionMI0000408 (change log)
Symbol MGI:Mir130b
DescriptionMus musculus miR-130b stem-loop
Gene family MIPF0000034; mir-130
Literature search

82 open access papers mention mmu-mir-130b
(312 sentences)

Stem-loop
         u    ca       cc         a  guggg  u 
5' ggcuug ugga  cucuuuc  uguugcacu cu     cc c
   |||||| ||||  |||||||  ||||||||| ||     ||  
3' ccgggc gucu  gggaaag  guaacguga ga     gg u
         u    ac       ua         c  ----a  g 
Get sequence
Deep sequencing
99508 reads, 272 reads per million, 106 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 17124061-17124142 [-]
sense
ENSMUST00000093336 ; 2610318N02Rik-201; intron 1
Clustered miRNAs
< 10kb from mmu-mir-130b
mmu-mir-301bchr16: 17124400-17124496 [-]
mmu-mir-130bchr16: 17124061-17124142 [-]
Database links

Mature sequence mmu-miR-130b-5p

Accession MIMAT0004583
Previous IDsmmu-miR-130b*
Sequence

13 - 

acucuuucccuguugcacuacu

 - 34

Get sequence
Deep sequencing8527 reads, 95 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-130b-3p

Accession MIMAT0000387
Previous IDsmmu-miR-130b
Sequence

51 - 

cagugcaaugaugaaagggcau

 - 72

Get sequence
Deep sequencing90954 reads, 106 experiments
Evidence experimental; cloned [1-3], Northern [1], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).