Stem-loop sequence mmu-mir-106a

Accession MI0000406
Symbol MGI:Mir106a
Description Mus musculus miR-106a stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    -ca       aa  g     -gu       
augu   aagugcu  ca ugcag   agcuuu 
||||   |||||||  || |||||   ||||| u
uaca   uucacga  gu acguc   uugagu 
    uuc       cc  g     auc       
Get sequence
Deep sequencing
1877685 reads, 97 experiments
Comments

Mouse and human miR-106a (MI0000406 and MI0000113 ) differ at two positions but the precursor sequences are clearly closely related. The sequences are also related to mir-17 (MI0000071 and MI0000687 ). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chrX: 52742503-52742567 [-]
sense
OTTMUST00000042260 ; Kis2-004; exon 2
OTTMUST00000042259 ; Kis2-003; exon 2
OTTMUST00000042258 ; Kis2-002; exon 2
OTTMUST00000042121 ; Kis2-001; exon 3
ENSMUST00000154488 ; Kis2-004; exon 2
ENSMUST00000133214 ; Kis2-003; exon 2
ENSMUST00000138156 ; Kis2-002; exon 2
ENSMUST00000143479 ; Kis2-001; exon 3
Clustered miRNAs
< 10kb from mmu-mir-106a
mmu-mir-106a chrX: 52742503-52742567 [-]
mmu-mir-18b chrX: 52742331-52742413 [-]
mmu-mir-20b chrX: 52742113-52742192 [-]
mmu-mir-19b-2 chrX: 52741983-52742066 [-]
mmu-mir-92a-2 chrX: 52741838-52741928 [-]
mmu-mir-363 chrX: 52741693-52741767 [-]
Database links

Mature sequence mmu-miR-106a-5p

Accession MIMAT0000385
Previous IDs mmu-miR-106a
Sequence

5 - 

caaagugcuaacagugcagguag

 - 27

Get sequence
Deep sequencing 196191 reads, 82 experiments
Evidence experimental; cloned [1-2], Solexa [3-4]
Validated targets
Predicted targets

Mature sequence mmu-miR-106a-3p

Accession MIMAT0017009
Previous IDs mmu-miR-106a*
Sequence

41 - 

acugcagugccagcacuucuuac

 - 63

Get sequence
Deep sequencing 214 reads, 31 experiments
Evidence experimental; Solexa [4]
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).