Stem-loop sequence mmu-mir-34b

AccessionMI0000404 (change log)
Symbol MGI:Mir34b
DescriptionMus musculus miR-34b stem-loop
Gene family MIPF0000039; mir-34
Literature search

208 open access papers mention mmu-mir-34b
(1234 sentences)

Stem-loop
        cg    -gua       uaa    c       -   g 
5' gugcu  guuu    ggcagug   uuag ugauugu agu c
   |||||  ||||    |||||||   |||| ||||||| ||| g
3' cacgg  caaa    ccgucac   aauc acuaaca ucg g
        aa    acua       cuc    -       g   u 
Get sequence
Deep sequencing
5782618 reads, 3.01e+04 reads per million, 109 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells [1], and named them miR-34a, miR-34b and miR-172. These names have been remapped to miR-34c (MI0000403), miR-34b (MI0000404) and miR-34a (MI0000584) to clarify homology with human sequences. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 51103562-51103645 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-34b
mmu-mir-34bchr9: 51103562-51103645 [-]
mmu-mir-34cchr9: 51103034-51103110 [-]
Database links

Mature sequence mmu-miR-34b-5p

Accession MIMAT0000382
Previous IDsmmu-miR-34b
Sequence

14 - 

aggcaguguaauuagcugauugu

 - 36

Get sequence
Deep sequencing5764887 reads, 106 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-34b-3p

Accession MIMAT0004581
Sequence

51 - 

aaucacuaacuccacugccauc

 - 72

Get sequence
Deep sequencing17707 reads, 85 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).