Stem-loop sequence mmu-mir-34b

Accession MI0000404
Symbol MGI:Mir34b
Description Mus musculus miR-34b stem-loop
Gene family MIPF0000039; mir-34
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-34_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-34 microRNA precursor family are non-coding RNA molecules that, in mammals, give rise to three major mature miRNAs. The miR-34 family members were discovered computationally and later verified experimentally. The precursor miRNA stem-loop is processed in the cytoplasm of the cell, with the predominant miR-34 mature sequence excised from the 5' arm of the hairpin. The mature miR-34a is a part of the p53 tumor suppressor network of proteins; therefore, it is hypothesized that miR-34 dysregulation is involved in the development of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     cg    -gua       uaa    c       -   g 
gugcu  guuu    ggcagug   uuag ugauugu agu c
|||||  ||||    |||||||   |||| ||||||| ||| g
cacgg  caaa    ccgucac   aauc acuaaca ucg g
     aa    acua       cuc    -       g   u 
Get sequence
Deep sequencing
654395 reads, 97 experiments
Comments

Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells [1], and named them miR-34a, miR-34b and miR-172. These names have been remapped to miR-34c (MI0000403 ), miR-34b (MI0000404 ) and miR-34a (MI0000584 ) to clarify homology with human sequences. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr9: 51103562-51103645 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-34b
mmu-mir-34b chr9: 51103562-51103645 [-]
mmu-mir-34c chr9: 51103034-51103110 [-]
Database links

Mature sequence mmu-miR-34b-5p

Accession MIMAT0000382
Previous IDs mmu-miR-34b
Sequence

14 - 

aggcaguguaauuagcugauugu

 - 36

Get sequence
Deep sequencing 649130 reads, 82 experiments
Evidence experimental; cloned [1-2], Solexa [3-4]
Validated targets
Predicted targets

Mature sequence mmu-miR-34b-3p

Accession MIMAT0004581
Sequence

51 - 

aaucacuaacuccacugccauc

 - 72

Get sequence
Deep sequencing 4048 reads, 58 experiments
Evidence experimental; cloned [2], Solexa [3-4]
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).