Stem-loop sequence mmu-mir-34c

AccessionMI0000403 (change log)
Previous IDsmmu-mir-34a
Symbol MGI:Mir34c
DescriptionMus musculus miR-34c stem-loop
Gene family MIPF0000039; mir-34
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-34_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-34 microRNA precursor family are non-coding RNA molecules that, in mammals, give rise to three major mature miRNAs. The miR-34 family members were discovered computationally and later verified experimentally. The precursor miRNA stem-loop is processed in the cytoplasm of the cell, with the predominant miR-34 mature sequence excised from the 5' arm of the hairpin. The mature miR-34a is a part of the p53 tumor suppressor network; therefore, it is hypothesized that miR-34 dysregulation is involved in the development of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
        ag     a   a    a     c      c  a 
5' agucu  uuacu ggc gugu guuag ugauug ua u
   |||||  ||||| ||| |||| ||||| |||||| ||  
3' ucaga  aaugg ccg caca caauc acuaac au a
        aa     a   a    c     -      c  g 
Get sequence
Deep sequencing
825913 reads, 1.25e+04 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells [1], and named them miR-34a, miR-34b and miR-172. These names have been remapped to miR-34c (MI0000403), miR-34b (MI0000404) and miR-34a (MI0000584) to clarify homology with human sequences.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 51103034-51103110 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-34c
mmu-mir-34bchr9: 51103562-51103645 [-]
mmu-mir-34cchr9: 51103034-51103110 [-]
Database links

Mature sequence mmu-miR-34c-5p

Accession MIMAT0000381
Previous IDsmmu-miR-34c
Sequence

13 - 

aggcaguguaguuagcugauugc

 - 35

Get sequence
Deep sequencing823248 reads, 76 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-34c-3p

Accession MIMAT0004580
Previous IDsmmu-miR-34c*
Sequence

46 - 

aaucacuaaccacacagccagg

 - 67

Get sequence
Deep sequencing2664 reads, 50 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).