Stem-loop sequence mmu-mir-302a

AccessionMI0000402 (change log)
Previous IDsmmu-mir-302
Symbol MGI:Mir302a
DescriptionMus musculus miR-302a stem-loop
Gene family MIPF0000071; mir-302
Stem-loop
      c    u        uu           aga 
5' cca cacu aaacgugg  guacuugcuuu   c
   ||| |||| ||||||||  |||||||||||   c
3' ggu gugg uuuguacc  cgugaaugaaa   u
      a    u        uu           gaa 
Get sequence
Deep sequencing
4495 reads, 58.8 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 127545496-127545564 [+]
antisense
ENSMUST00000029588 ; Larp7-201; intron 8
Clustered miRNAs
< 10kb from mmu-mir-302a
mmu-mir-302bchr3: 127545228-127545301 [+]
mmu-mir-302cchr3: 127545363-127545430 [+]
mmu-mir-302achr3: 127545496-127545564 [+]
mmu-mir-302dchr3: 127545624-127545689 [+]
mmu-mir-367chr3: 127545733-127545807 [+]
Database links

Mature sequence mmu-miR-302a-5p

Accession MIMAT0004579
Previous IDsmmu-miR-302a*
Sequence

6 - 

acuuaaacgugguuguacuugc

 - 27

Get sequence
Deep sequencing319 reads, 13 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-302a-3p

Accession MIMAT0000380
Previous IDsmmu-miR-302;mmu-miR-302a
Sequence

44 - 

uaagugcuuccauguuuugguga

 - 66

Get sequence
Deep sequencing4176 reads, 17 experiments
Evidence experimental; cloned [1-2], Northern [1], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).