Stem-loop sequence mmu-mir-300

AccessionMI0000400 (change log)
Symbol MGI:Mir300
DescriptionMus musculus miR-300 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
      a           g  au             gc   a 
5' gcu cuugaagagag uu  ccuuuguguguuu  uuu c
   ||| ||||||||||| ||  |||||||||||||  |||  
3' cga gagcuucucuc aa  gggaacguauaag  aag g
      g           g  -c             ua   c 
Get sequence
Deep sequencing
118865 reads, 1.31e+03 reads per million, 61 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109724313-109724391 [+]
sense
ENSMUST00000083485 ; mmu-mir-300.1-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-300
mmu-mir-494chr12: 109715318-109715402 [+]
mmu-mir-679chr12: 109715577-109715650 [+]
mmu-mir-1193chr12: 109715671-109715791 [+]
mmu-mir-666chr12: 109717085-109717183 [+]
mmu-mir-543chr12: 109717258-109717333 [+]
mmu-mir-495chr12: 109718754-109718816 [+]
mmu-mir-667chr12: 109720006-109720097 [+]
mmu-mir-376cchr12: 109722718-109722803 [+]
mmu-mir-654chr12: 109723218-109723301 [+]
mmu-mir-376bchr12: 109723458-109723539 [+]
mmu-mir-376achr12: 109723781-109723848 [+]
mmu-mir-300chr12: 109724313-109724391 [+]
mmu-mir-381chr12: 109726822-109726896 [+]
mmu-mir-487bchr12: 109727333-109727414 [+]
mmu-mir-539chr12: 109728129-109728202 [+]
mmu-mir-544chr12: 109729325-109729402 [+]
mmu-mir-382chr12: 109733771-109733846 [+]
mmu-mir-134chr12: 109734139-109734209 [+]
Database links

Mature sequence mmu-miR-300-5p

Accession MIMAT0004578
Previous IDsmmu-miR-300*
Sequence

6 - 

uugaagagagguuauccuuugu

 - 27

Get sequence
Deep sequencing4039 reads, 34 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-300-3p

Accession MIMAT0000378
Previous IDsmmu-miR-300
Sequence

51 - 

uaugcaagggcaagcucucuuc

 - 72

Get sequence
Deep sequencing114821 reads, 60 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).