Stem-loop sequence mmu-mir-299a

AccessionMI0000399 (change log)
Previous IDsmmu-mir-299
Symbol MGI:Mir299a
DescriptionMus musculus miR-299 stem-loop
Gene family MIPF0000186; mir-299
Literature search

25 open access papers mention mmu-mir-299a
(94 sentences)

        a                      uu 
5' aagaa ugguuuaccgucccacauacau  u
   ||||| ||||||||||||||||||||||  g
3' uucuu gccaaauggcaggguguaugua  a
        c                      ug 
Get sequence
Deep sequencing
33040 reads, 235 reads per million, 91 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109710638-109710700 [+]
ENSMUST00000175550 ; Gm25400-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-299a
mmu-mir-379chr12: 109709060-109709125 [+]
mmu-mir-411chr12: 109710175-109710256 [+]
mmu-mir-299achr12: 109710638-109710700 [+]
mmu-mir-299bchr12: 109710645-109710693 [-]
mmu-mir-380chr12: 109711803-109711863 [+]
mmu-mir-1197chr12: 109712317-109712436 [+]
mmu-mir-323chr12: 109712508-109712593 [+]
mmu-mir-758chr12: 109712810-109712890 [+]
mmu-mir-329chr12: 109713481-109713577 [+]
mmu-mir-494chr12: 109715318-109715402 [+]
mmu-mir-679chr12: 109715577-109715650 [+]
mmu-mir-1193chr12: 109715671-109715791 [+]
mmu-mir-666chr12: 109717085-109717183 [+]
mmu-mir-543chr12: 109717258-109717333 [+]
mmu-mir-495chr12: 109718754-109718816 [+]
mmu-mir-667chr12: 109720006-109720097 [+]
Database links

Mature sequence mmu-miR-299a-5p

Accession MIMAT0000377
Previous IDsmmu-miR-299;mmu-miR-299*;mmu-miR-299-5p

7 - 


 - 28

Get sequence
Deep sequencing7643 reads, 71 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-299a-3p

Accession MIMAT0004577
Previous IDsmmu-miR-299;mmu-miR-299-3p

39 - 


 - 60

Get sequence
Deep sequencing25397 reads, 88 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets


PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).