Stem-loop sequence mmu-mir-298

AccessionMI0000398 (change log)
Symbol MGI:Mir298
DescriptionMus musculus miR-298 stem-loop
Gene family MIPF0000206; mir-298
Stem-loop
      gg   uu   a   -       -         uug    u 
5' cca  ccu  ggc gag gagggcu guucuuccc   aguu u
   |||  |||  ||| ||| ||||||| |||||||||   ||||  
3' ggu  gga  ucg cuc cuuccga caaggaggg   ucag a
      ga   -u   a   u       u         ---    u 
Get sequence
Deep sequencing
372436 reads, 1.05e+03 reads per million, 75 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 174267504-174267585 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-298
mmu-mir-298chr2: 174267504-174267585 [-]
mmu-mir-296chr2: 174267047-174267125 [-]
Database links

Mature sequence mmu-miR-298-5p

Accession MIMAT0000376
Previous IDsmmu-miR-298
Sequence

11 - 

ggcagaggagggcuguucuuccc

 - 33

Get sequence
Deep sequencing372080 reads, 75 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-298-3p

Accession MIMAT0017007
Previous IDsmmu-miR-298*
Sequence

51 - 

gaggaacuagccuucucucagcuu

 - 74

Get sequence
Deep sequencing352 reads, 50 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).