Stem-loop sequence mmu-mir-297a-2

AccessionMI0000397 (change log)
Previous IDsmmu-mir-297-3;mmu-mir-297-2
Symbol MGI:Mir297a-2
DescriptionMus musculus miR-297a-2 stem-loop
Gene family MIPF0000204; mir-297
Literature search

12 open access papers mention mmu-mir-297a-2
(15 sentences)

Stem-loop
   ----c       au    a      --c      au           ag 
5'      ugugugu  augu ugugug   augugc  guguguauaug  u
        |||||||  |||| ||||||   ||||||  |||||||||||   
3'      acacacg  uacg acauac   uacacg  cauacauauac  a
   cccaa       --    a      cca      --           au 
Get sequence
Deep sequencing
15706 reads, 1.05e+03 reads per million, 107 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Houbaviy et al. report that the cloned sequence of miR-297 is found over 20 times in the mouse genomic sequence [1]. This sequence appears to match several low complexity repetitive regions. Confidence in which loci actually express miR-297 is low because of the low complexity nature of the sequence.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10472254-10472343 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-297a-2
mmu-mir-466mchr2: 10466663-10466746 [+]
mmu-mir-466f-1chr2: 10466944-10467037 [+]
mmu-mir-669fchr2: 10467229-10467349 [+]
mmu-mir-669echr2: 10467495-10467613 [+]
mmu-mir-669bchr2: 10467790-10467886 [+]
mmu-mir-669dchr2: 10468343-10468463 [+]
mmu-mir-466f-2chr2: 10468675-10468768 [+]
mmu-mir-669lchr2: 10468971-10469068 [+]
mmu-mir-669d-2chr2: 10471644-10471729 [+]
mmu-mir-466f-3chr2: 10471953-10472046 [+]
mmu-mir-297a-2chr2: 10472254-10472343 [+]
mmu-mir-466ochr2: 10472540-10472623 [+]
mmu-mir-467cchr2: 10473931-10474027 [+]
mmu-mir-466b-1chr2: 10474219-10474300 [+]
mmu-mir-669a-3chr2: 10474433-10474541 [+]
mmu-mir-669kchr2: 10475300-10475426 [+]
mmu-mir-467a-1chr2: 10476346-10476418 [+]
mmu-mir-466b-8chr2: 10476628-10476713 [+]
mmu-mir-669a-1chr2: 10476853-10476949 [+]
mmu-mir-669gchr2: 10477150-10477272 [+]
mmu-mir-669jchr2: 10477910-10478030 [+]
mmu-mir-467a-2chr2: 10478798-10478880 [+]
mmu-mir-466echr2: 10479088-10479171 [+]
mmu-mir-669a-4chr2: 10479315-10479401 [+]
mmu-mir-467bchr2: 10481248-10481320 [+]
mmu-mir-466c-1chr2: 10481534-10481617 [+]
mmu-mir-669a-5chr2: 10481761-10481847 [+]
Database links

Mature sequence mmu-miR-297a-5p

Accession MIMAT0000375
Previous IDsmmu-miR-297;mmu-miR-297a
Sequence

11 - 

auguaugugugcaugugcaugu

 - 32

Get sequence
Deep sequencing44321 reads, 109 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).