Stem-loop sequence mmu-mir-297a-1

AccessionMI0000395 (change log)
Previous IDsmmu-mir-297-1
DescriptionMus musculus miR-297a-1 stem-loop
Gene family MIPF0000204; mir-297
Stem-loop
                u       ug    -        ug 
5' auauguauguaug auguaug  ugca ugugcaug  c
   ||||||||||||| |||||||  |||| ||||||||   
3' uguacauacguau uauauau  acgu auacguau  a
                -       gu    u        gu 
Get sequence
Deep sequencing
9694 reads, 75.4 reads per million, 61 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Houbaviy et al. report that the cloned sequence of miR-297 is found over 20 times in the mouse genomic sequence [1]. This sequence appears to match several low complexity repetitive regions. Confidence in which loci actually express miR-297 is low because of the low complexity nature of the sequence. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 10958437-10958512 [-]
intergenic
Database links

Mature sequence mmu-miR-297a-5p

Accession MIMAT0000375
Previous IDsmmu-miR-297;mmu-miR-297a
Sequence

15 - 

auguaugugugcaugugcaugu

 - 36

Get sequence
Deep sequencing41157 reads, 66 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).