Stem-loop sequence mmu-mir-296

Accession MI0000394
Symbol MGI:Mir296
Description Mus musculus miR-296 stem-loop
Gene family MIPF0000159; mir-296
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-296. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-296 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-296 has been named an "angiomiR" due to being characterised as a microRNA which regulates angiogenesis, the process of growth and creation of new blood vessels. miR-296 is thought to have a specific role in cancer in promoting tumour angiogenesis. It achieves this by targeting HGS mRNA, reducing its expression in endothelial cells which then results in greater number of VEGF receptors. miR-296 has predicted target sites in the transcription factor NANOG and may also contribute to carcinogenesis by dysregulating p53.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    -     u        c  c         g   -u c 
gggc cuuuc ggagggcc cc cucaauccu uug  g u
|||| ||||| |||||||| || ||||||||| |||  |  
ccug ggaag ccucucgg gg ggguuggga gac  c c
    u     u        a  u         -   uu g 
Get sequence
Deep sequencing
38030 reads, 92 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr2: 174267047-174267125 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-296
mmu-mir-298 chr2: 174267504-174267585 [-]
mmu-mir-296 chr2: 174267047-174267125 [-]
Database links

Mature sequence mmu-miR-296-5p

Accession MIMAT0000374
Previous IDs mmu-miR-296
Sequence

13 - 

agggcccccccucaauccugu

 - 33

Get sequence
Deep sequencing 20945 reads, 77 experiments
Evidence experimental; cloned [1-2], Northern [1], Solexa [3-4]
Validated targets
Predicted targets

Mature sequence mmu-miR-296-3p

Accession MIMAT0004576
Sequence

47 - 

gaggguuggguggaggcucucc

 - 68

Get sequence
Deep sequencing 13156 reads, 77 experiments
Evidence experimental; cloned [2], Solexa [3-4]
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).