Stem-loop sequence mmu-mir-296

AccessionMI0000394 (change log)
Symbol MGI:Mir296
DescriptionMus musculus miR-296 stem-loop
Gene family MIPF0000159; mir-296
Literature search

37 open access papers mention mmu-mir-296
(134 sentences)

Stem-loop
       -     u        c  c         g   -u c 
5' gggc cuuuc ggagggcc cc cucaauccu uug  g u
   |||| ||||| |||||||| || ||||||||| |||  |  
3' ccug ggaag ccucucgg gg ggguuggga gac  c c
       u     u        a  u         -   uu g 
Get sequence
Deep sequencing
84718 reads, 275 reads per million, 104 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 174267047-174267125 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-296
mmu-mir-298chr2: 174267504-174267585 [-]
mmu-mir-296chr2: 174267047-174267125 [-]
Database links

Mature sequence mmu-miR-296-5p

Accession MIMAT0000374
Previous IDsmmu-miR-296
Sequence

13 - 

agggcccccccucaauccugu

 - 33

Get sequence
Deep sequencing19931 reads, 101 experiments
Evidence experimental; cloned [1-2], Northern [1], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-296-3p

Accession MIMAT0004576
Sequence

47 - 

gaggguuggguggaggcucucc

 - 68

Get sequence
Deep sequencing64786 reads, 103 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).