Stem-loop sequence mmu-mir-295

AccessionMI0000393 (change log)
Symbol MGI:Mir295
DescriptionMus musculus miR-295 stem-loop
Gene family MIPF0000068; mir-290
Stem-loop
     u          u    -     ac     gac 
5' gg gagacucaaa gugg ggcac  uucug   u
   || |||||||||| |||| |||||  |||||   g
3' cc cucugaguuu cauc ucgug  aagau   u
     u          u    a     -a     aca 
Get sequence
Deep sequencing
85215 reads, 879 reads per million, 47 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 3220773-3220841 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-295
mmu-mir-290achr7: 3218626-3218708 [+]
mmu-mir-290bchr7: 3218638-3218695 [-]
mmu-mir-291achr7: 3218919-3219000 [+]
mmu-mir-292achr7: 3219189-3219270 [+]
mmu-mir-292bchr7: 3219198-3219259 [-]
mmu-mir-291bchr7: 3219482-3219560 [+]
mmu-mir-293chr7: 3220343-3220422 [+]
mmu-mir-294chr7: 3220641-3220724 [+]
mmu-mir-295chr7: 3220773-3220841 [+]
Database links

Mature sequence mmu-miR-295-5p

Accession MIMAT0004575
Previous IDsmmu-miR-295*
Sequence

7 - 

acucaaauguggggcacacuuc

 - 28

Get sequence
Deep sequencing5484 reads, 17 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-295-3p

Accession MIMAT0000373
Previous IDsmmu-miR-295
Sequence

43 - 

aaagugcuacuacuuuugagucu

 - 65

Get sequence
Deep sequencing79711 reads, 42 experiments
Evidence experimental; cloned [1-2], Northern [1], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).