Stem-loop sequence mmu-mir-294

AccessionMI0000392 (change log)
Symbol MGI:Mir294
DescriptionMus musculus miR-294 stem-loop
Gene family MIPF0000068; mir-290
Stem-loop
   u       a  c    u     u      c  a   aa   u 
5'  uccauau gc auac caaaa ggaggc cu ucu  gcu u
    ||||||| || |||| ||||| |||||| || |||  |||  
3'  aggugua cg ugug guuuu ccuucg ga agg  uga u
   g       c  u    u     c      u  a   --   a 
Get sequence
Deep sequencing
52565 reads, 937 reads per million, 27 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 3220641-3220724 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-294
mmu-mir-290achr7: 3218626-3218708 [+]
mmu-mir-290bchr7: 3218638-3218695 [-]
mmu-mir-291achr7: 3218919-3219000 [+]
mmu-mir-292achr7: 3219189-3219270 [+]
mmu-mir-292bchr7: 3219198-3219259 [-]
mmu-mir-291bchr7: 3219482-3219560 [+]
mmu-mir-293chr7: 3220343-3220422 [+]
mmu-mir-294chr7: 3220641-3220724 [+]
mmu-mir-295chr7: 3220773-3220841 [+]
Database links

Mature sequence mmu-miR-294-5p

Accession MIMAT0004574
Previous IDsmmu-miR-294*
Sequence

15 - 

acucaaaauggaggcccuaucu

 - 36

Get sequence
Deep sequencing2920 reads, 11 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-294-3p

Accession MIMAT0000372
Previous IDsmmu-miR-294
Sequence

51 - 

aaagugcuucccuuuugugugu

 - 72

Get sequence
Deep sequencing49642 reads, 27 experiments
Evidence experimental; cloned [1-2], Northern [1], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).