Stem-loop sequence mmu-mir-293

AccessionMI0000391 (change log)
Symbol MGI:Mir293
DescriptionMus musculus miR-293 stem-loop
Gene family MIPF0000068; mir-290
Stem-loop
   u      u  gg    -      g    a      guuc 
5'  ucaauc gu  uacu caaacu ugug cauuuu    u
    |||||| ||  |||| |||||| |||| ||||||    u
3'  aguuag cg  guga guuuga acgc gugaag    u
   g      c  uu    u      g    c      aaug 
Get sequence
Deep sequencing
151682 reads, 1.72e+03 reads per million, 44 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 3220343-3220422 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-293
mmu-mir-290achr7: 3218626-3218708 [+]
mmu-mir-290bchr7: 3218638-3218695 [-]
mmu-mir-291achr7: 3218919-3219000 [+]
mmu-mir-292achr7: 3219189-3219270 [+]
mmu-mir-292bchr7: 3219198-3219259 [-]
mmu-mir-291bchr7: 3219482-3219560 [+]
mmu-mir-293chr7: 3220343-3220422 [+]
mmu-mir-294chr7: 3220641-3220724 [+]
mmu-mir-295chr7: 3220773-3220841 [+]
Database links

Mature sequence mmu-miR-293-5p

Accession MIMAT0004573
Previous IDsmmu-miR-293*
Sequence

14 - 

acucaaacugugugacauuuug

 - 35

Get sequence
Deep sequencing13072 reads, 17 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-293-3p

Accession MIMAT0000371
Previous IDsmmu-miR-293
Sequence

48 - 

agugccgcagaguuuguagugu

 - 69

Get sequence
Deep sequencing138607 reads, 44 experiments
Evidence experimental; cloned [1-2], Northern [1], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).