Stem-loop sequence mmu-mir-291a

AccessionMI0000389 (change log)
Previous IDsmmu-mir-291
Symbol MGI:Mir291a
DescriptionMus musculus miR-291a stem-loop
Gene family MIPF0000068; mir-290
Stem-loop
            c   -  u            c  c    gagc 
5' ccuauguag ggc ca caaaguggaggc cu ucuu    c
   ||||||||| ||| || |||||||||||| || ||||     
3' ggguacguc ccg gu guuucaccuucg ga agag    u
            a   u  -            u  a    uaag 
Get sequence
Deep sequencing
69080 reads, 1.03e+03 reads per million, 32 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 3218919-3219000 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-291a
mmu-mir-290achr7: 3218626-3218708 [+]
mmu-mir-290bchr7: 3218638-3218695 [-]
mmu-mir-291achr7: 3218919-3219000 [+]
mmu-mir-292achr7: 3219189-3219270 [+]
mmu-mir-292bchr7: 3219198-3219259 [-]
mmu-mir-291bchr7: 3219482-3219560 [+]
mmu-mir-293chr7: 3220343-3220422 [+]
mmu-mir-294chr7: 3220641-3220724 [+]
mmu-mir-295chr7: 3220773-3220841 [+]
Database links

Mature sequence mmu-miR-291a-5p

Accession MIMAT0000367
Previous IDsmmu-miR-291-5p
Sequence

14 - 

caucaaaguggaggcccucucu

 - 35

Get sequence
Deep sequencing42808 reads, 25 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-291a-3p

Accession MIMAT0000368
Previous IDsmmu-miR-291-3p
Sequence

50 - 

aaagugcuuccacuuugugugc

 - 71

Get sequence
Deep sequencing26268 reads, 24 experiments
Evidence experimental; cloned [1-2], Northern [1], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).