Stem-loop sequence mmu-mir-290a

AccessionMI0000388 (change log)
Symbol MGI:Mir290a
DescriptionMus musculus miR-290a stem-loop
Gene family MIPF0000068; mir-290
Stem-loop
       u  u    ua  -c      u  g          uuu 
5' cuca cu gcgg  cu  aaacua gg ggcacuuuuu   u
   |||| || ||||  ||  |||||| || ||||||||||   u
3' gagu gg cgcc  ga  uuugau cc ccgugaaaaa   c
       u  c    cc  au      -  g          uuu 
Get sequence
Deep sequencing
48390 reads, 920 reads per million, 25 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 3218626-3218708 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-290a
mmu-mir-290achr7: 3218626-3218708 [+]
mmu-mir-290bchr7: 3218638-3218695 [-]
mmu-mir-291achr7: 3218919-3219000 [+]
mmu-mir-292achr7: 3219189-3219270 [+]
mmu-mir-292bchr7: 3219198-3219259 [-]
mmu-mir-291bchr7: 3219482-3219560 [+]
mmu-mir-293chr7: 3220343-3220422 [+]
mmu-mir-294chr7: 3220641-3220724 [+]
mmu-mir-295chr7: 3220773-3220841 [+]
Database links

Mature sequence mmu-miR-290a-5p

Accession MIMAT0000366
Previous IDsmmu-miR-290
Sequence

14 - 

acucaaacuaugggggcacuuu

 - 35

Get sequence
Deep sequencing48122 reads, 20 experiments
Evidence experimental; cloned [1-2], Northern [1], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-290a-3p

Accession MIMAT0004572
Sequence

49 - 

aaagugccgccuaguuuuaagccc

 - 72

Get sequence
Deep sequencing260 reads, 7 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).