Stem-loop sequence dme-bantam

AccessionMI0000387 (change log)
Previous IDsdme-bantam;bantam
DescriptionDrosophila melanogaster bantam stem-loop
Gene family MIPF0000153; bantam
Literature search

108 open access papers mention dme-bantam
(712 sentences)

Stem-loop
   au     uac    c          uu      g   -  uu 
5'   uugac   gaaa cgguuuucga  ugguuu acu gu  u
     |||||   |||| ||||||||||  |||||| ||| ||  u
3'   aacug   uuuu gucgaaaguu  acuaga uga ca  c
   --     ---    a          uu      g   a  ua 
Get sequence
Deep sequencing
11412612 reads, 5.83e+04 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

bantam microRNA was predicted independently by two groups using computational approaches [1,2]. Northern blotting confirmed that the strand containing the predicted miR is predominantly expressed. Subsequent cloning studies have independently identified the same miRNA and confirmed the 5' end [3]. A length distribution of 20-23 nt was reported with a 23 nt sequence the most commonly expressed. bantam is reported to promote tissue growth [1]. bantam expression is temporally and spatially regulated in response to patterning cues. bantam microRNA simultaneously stimulates cell proliferation and prevents apoptosis and is predicted to target the pro-apoptotic gene hid [1].

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3L: 642208-642288 [+]
sense
FBtr0306918 ; CR43334-RA; exon 1
FBtr0333725 ; CR43334-RC; exon 1
FBtr0333724 ; CR43334-RB; exon 1
Database links

Mature sequence dme-bantam-5p

Accession MIMAT0020823
Sequence

15 - 

ccgguuuucgauuugguuugacu

 - 37

Get sequence
Deep sequencing706883 reads, 49 experiments
Evidence not experimental
Database links

Mature sequence dme-bantam-3p

Accession MIMAT0000365
Previous IDsdme-bantam
Sequence

52 - 

ugagaucauuuugaaagcugauu

 - 74

Get sequence
Deep sequencing10705728 reads, 49 experiments
Evidence experimental; Northern [1], cloned [3], 454 [5-6], Illumina [6]
Database links
Predicted targets

References

1
2
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:12946623 "Big things from a little RNA" Moberg KH, Hariharan IK Trends Cell Biol. 13:455-457(2003).
5
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
6
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).