Stem-loop sequence dme-mir-289

AccessionMI0000385 (change log)
DescriptionDrosophila melanogaster miR-289 stem-loop
Gene family MIPF0000222; mir-289
Literature search

3 open access papers mention dme-mir-289
(33 sentences)

Stem-loop
   -gag     a  -aa      ua         --a    g  acu      c 
5'     uuuac gu   aauaaa  uuuaagugg   gccu cg   ucaguc c
       ||||| ||   ||||||  |||||||||   |||| ||   |||||| u
3'     aaaug ca   uuguuu  gaguucacu   uggg gu   agucag c
   caga     -  cgg      gc         gaa    -  --c      u 
Get sequence
Deep sequencing
2969 reads, 300 reads per million, 48 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is computationally predicted based on conservation in D. pseudoobscura. The precise 5' or 3' ends are unknown. Northern blotting confirmed that the strand containing the predicted miR is predominantly expressed.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3L: 13620822-13620920 [+]
antisense
FBtr0330351 ; bru-3-RH; intron 3
FBtr0330355 ; bru-3-RM; intron 3
FBtr0330352 ; bru-3-RE; intron 3
FBtr0330353 ; bru-3-RG; intron 3
FBtr0330345 ; bru-3-RI; intron 3
FBtr0330344 ; bru-3-RD; intron 3
FBtr0330346 ; bru-3-RF; intron 3
FBtr0330347 ; bru-3-RB; intron 3
FBtr0330348 ; bru-3-RK; intron 3
FBtr0330350 ; bru-3-RL; intron 3
FBtr0330354 ; bru-3-RJ; intron 3
FBtr0330343 ; bru-3-RA; intron 4
FBtr0330349 ; bru-3-RC; intron 4
FBtr0330357 ; bru-3-RO; intron 5
FBtr0330356 ; bru-3-RN; intron 5
Database links

Mature sequence dme-miR-289-5p

Accession MIMAT0000364
Previous IDsdme-miR-289
Sequence

16 - 

uaaauauuuaaguggagccugcgacu

 - 41

Get sequence
Deep sequencing2959 reads, 48 experiments
Evidence experimental; Northern [1]
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).