Stem-loop sequence dme-mir-288

AccessionMI0000384 (change log)
DescriptionDrosophila melanogaster miR-288 stem-loop
Gene family MIPF0000223; mir-288
Stem-loop
        a      aauuagcg   ca      --c       auaauuaa    g 
5' cggcc ugucgu        gag  cggcau   gccggcg        ugac g
   ||||| ||||||        |||  ||||||   |||||||        ||||  
3' gccgg acagua        cuu  gcugua   ugguugc        acug u
        c      ---cuuua   ua      cuu       --------    g 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is computationally predicted based on conservation in D. pseudoobscura. The precise 5' or 3' ends are unknown. Northern blotting confirmed that the strand containing the predicted miR is predominantly expressed.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 20618366-20618462 [-]
intergenic
Clustered miRNAs
< 10kb from dme-mir-288
dme-mir-288chr2L: 20618366-20618462 [-]
dme-mir-133chr2L: 20616617-20616714 [+]
Database links

Mature sequence dme-miR-288-3p

Accession MIMAT0000363
Previous IDsdme-miR-288
Sequence

66 - 

uuucaugucgauuucauuucaug

 - 88

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Northern [1]
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).